Informations

Les cicatrices continuent-elles généralement à subir des changements bénéfiques après maturation ?


Je comprends que succomber cicatrisation, une cicatrice modulée passerait par un processus de cicatrisation des cicatrices que je comprends être remodulation et maturation.

Les cicatrices continuent-elles généralement à évoluer de manière bénéfique tout au long de la vie d'un humain ?
C'est demander ; se pourrait-il que l'évolution d'une cicatrice puisse être composée de deux stades majeurs "primaire" et "secondaire" et que le stade primaire soit composé de remodulation et maturation et le secondaire comprend l'évolution « post-maturation » qui pourrait durer toute la vie d'un humain ?

En général, les cicatrices sont modifiées après avoir été « guéris », au moins par des changements corporels généraux dus au vieillissement affectant tous les tissus en général (y compris le tissu cicatriciel), mais il peut également y avoir une « évolution post-maturation ».


Le collagène qui maintient le tissu cicatriciel est continuellement dégradé et remplacé. (Chirurgie Plastique et Reconstructrice, 1976) Si la synthèse de collagène ralentit, à cause du scorbut par exemple, les anciennes plaies peuvent en théorie se rouvrir. Les archives historiques de voyages en mer contiennent des descriptions de blessures guéries depuis longtemps qui s'ouvrent de nouveau chez les victimes du scorbut, et ces cas sont cités avec autorité dans certains articles (par exemple Annals NYAS 1961), mais il est difficile de les tester expérimentalement.
Je décrirais cela davantage comme un « entretien » de la cicatrice, plutôt que comme une « cicatrisation continue », mais cela peut vous intéresser.


Résultats cliniques suite à l'application précoce de programmes de cicatrices multimodales pour les plaies incisionnelles faciales

Même si les cicatrices sont des problèmes majeurs pour les patients qui subissent des lacérations faciales, les programmes de prévention et de prise en charge précoce ne sont pas bien établis. Le but de cette étude était d'évaluer les résultats cliniques des évaluations prophylactiques des cicatrices et des interventions précoces des cicatrices chez les patients présentant des lacérations.

Patients et méthodes

Au total, 116 patients ont bénéficié d'un traitement de prévention des sutures et des cicatrices aux urgences de 2014 à 2015. Dans l'étude rétrospective, 46 patients répondant à tous les critères ont été inclus dans l'étude. Ils ont été affectés à l'un des deux programmes de prévention des cicatrices suivants : le programme de prévention des cicatrices standard, qui comprenait du ruban adhésif, des feuilles de silicone et des onguents, et le programme de traitement des cicatrices multimodales, qui comprenait de la triamcinolone, des toxines botuliques ou du CO.2 lasers fractionnaires. Les modèles de programme de cicatrice précoce ont été étudiés pour le programme de prévention des cicatrices standard et le programme de gestion des cicatrices multimodales, et nous avons évalué les scores d'évaluation des cicatrices des patients à 3 et 6 mois.

Résultats

Les scores de cicatrice pour les patients qui ont reçu une gestion multimodale des cicatrices ont montré des améliorations statistiquement significatives dans les échelles d'évaluation des cicatrices du patient (PSA), les échelles d'évaluation des cicatrices de Stony Brook (SBSES), les scores de l'échelle de cicatrice de Vancouver (VSS) et les échelles visuelles analogiques de cicatrice (VAS) (le p les valeurs étaient de 0,008, 0,007, 0,017 et 0,01, respectivement).

Conclusion

Le programme cicatrice multimodalité est plus efficace pour la prévention des cicatrices que le programme cicatrice standard.


VOIR l'article

Zrinka Bukvić Mokos 1 *, Anamaria Jovi&# x00107 1 , Lovorka Grgurevi&# x00107 2 , Ivo Dumić-Čule 2 , Krešimir Kostović 1 , Romana ჎ović 1 et Branka Marinovi&# x00107 1
  • 1 Département de dermatologie et de vénéréologie, Centre hospitalier universitaire de Zagreb, Faculté de médecine, Université de Zagreb, Zagreb, Croatie
  • 2 Laboratoire des tissus minéralisés, Faculté de médecine, Université de Zagreb, Zagreb, Croatie

Les cicatrices anormales et les séquelles esthétiques, fonctionnelles et psychologiques qui les accompagnent posent encore des défis importants. À ce jour, il n'existe pas d'option de prévention ou de traitement satisfaisante pour les cicatrices hypertrophiques (HS), ce qui est principalement dû à une compréhension incomplète des mécanismes sous-jacents à leur formation. C'est pourquoi l'appréhension des processus physiologiques réguliers et contrôlés de formation de cicatrices est de la plus haute importance face à la cicatrisation hypertrophique, sa physiopathologie, sa prévention et son approche thérapeutique. Lorsqu'ils traitent l'HS et choisissent la meilleure modalité de traitement et de prévention, les médecins peuvent choisir parmi une pléthore d'options thérapeutiques et de nombreux produits disponibles dans le commerce, parmi lesquels il n'existe actuellement aucune option efficace qui puisse surmonter avec succès la cicatrisation cutanée altérée. Cet article passe en revue l'approche thérapeutique actuelle et les stratégies thérapeutiques émergentes pour la prise en charge de l'HS, qui devraient être individualisées, sur la base d'une évaluation de la cicatrice elle-même, des attentes des patients et de directives pratiques fondées sur des preuves. Les cliniciens sont encouragés à combiner diverses modalités de prévention et de traitement où une thérapie combinée comprenant des injections de stéroïdes, du 5-fluorouracile et un laser à colorant pulsé semble être la plus efficace. D'autre part, les options thérapeutiques actuelles sont généralement empiriques et leurs résultats sont peu fiables et imprévisibles. Par conséquent, il existe un besoin non satisfait d'une thérapie et d'une prévention efficaces et ciblées, qui seraient basées sur une action ou une modulation d'un facteur particulier avec un mécanisme d'action clarifié qui a un effet bénéfique sur la cicatrisation des plaies. Comme la matrice extracellulaire a un rôle crucial dans les événements cellulaires et extracellulaires qui conduisent à des cicatrices pathologiques, le ciblage de ses composants principalement en régulant les protéines morphogénétiques osseuses peut lancer une nouvelle approche thérapeutique pour la réduction ou la prévention des HS avec des résultats fonctionnellement et cosmétiquement acceptables.


Introduction

La prévalence du syndrome des ovaires polykystiques (SOPK) varie d'environ 5 % à 20 % et varie selon l'origine ethnique et la définition utilisée.1 La proportion de femmes hypofertiles atteintes de SOPK est d'environ 50 %. les traitements conventionnels, tels que l'induction de l'ovulation et le forage ovarien laparoscopique,3 4 certains auront finalement besoin de techniques de procréation assistée telles que l'hyperstimulation ovarienne contrôlée (COH) et la fécondation in vitro (FIV). Cependant, l'HCO est coûteuse et est associée à un risque élevé de syndrome d'hyperstimulation ovarienne (SHO) chez les femmes atteintes du SOPK.5 6 De plus, la FIV peut être moins efficace chez les femmes atteintes du SOPK en raison du prélèvement d'ovocytes immatures ou de mauvaise qualité, à une réduction des taux de fécondation, de clivage, de grossesse et de naissances vivantes, et à un taux plus élevé de fausses couches.7

La maturation in vitro (IVM) est une alternative à la FIV conventionnelle et a été utilisée pour la première fois pour réussir la grossesse et l'accouchement en 19918. Les ovocytes immatures (stade de la vésicule germinale) sont récoltés à partir des follicules au stade antral précoce (2-10 mm), puis incubés dans du milieu IVM pendant 30 heures pour mûrir in vitro jusqu'à la métaphase II. Les ovocytes mûrs peuvent ensuite être utilisés pour les procédures standard de FIV ou d'injection intracytoplastique de spermatozoïdes (ICSI), bien que cette dernière soit généralement préférée pour éviter le durcissement de la zone des ovocytes.

La fécondation réussie, le développement de l'embryon et la grossesse à terme résultant d'ovocytes IVM ont été rapportés chez des femmes atteintes du SOPK.9 preuves que les résultats de la grossesse après la MIV sont similaires à ceux après la FIV conventionnelle.14 Cependant, une revue Cochrane publiée en 2013 a conclu qu'il n'y avait aucune preuve issue d'essais contrôlés randomisés sur laquelle baser des recommandations concernant l'utilisation de la MIV avant la FIV ou l'ICSI pour les femmes atteintes de Le SOPK en pratique clinique.9 Par conséquent, cette étude a été conçue pour évaluer l'efficacité et l'innocuité d'un cycle d'IVM (sans amorçage par la gonadotrophine chorionique humaine (hCG)) par rapport à un cycle de COH/FIV avec déclenchement par agoniste de la gonadolibérine (GnRH). (FIV avec segmentation) chez les femmes atteintes de SOPK ou d'un nombre élevé de follicules antraux (AFC).


Résumé

Après une lésion du système nerveux central (SNC) adulte, les axones blessés ne peuvent pas se régénérer au-delà de la lésion. Dans cette revue, nous présentons des preuves que cela est dû à la formation d'une cicatrice gliale. La chondroïtine et les protéoglycanes sulfate de kératane sont parmi les principales molécules inhibitrices de la matrice extracellulaire produites par les astrocytes réactifs dans la cicatrice gliale, et on pense qu'elles jouent un rôle crucial dans l'échec de la régénération. Nous nous concentrerons sur ce rôle, ainsi que sur le comportement des neurones en régénération dans l'environnement d'une lésion du SNC.

À l'exception d'une petite voie dans l'hypothalamus 1 et des projections sensorielles olfactives dans le bulbe olfactif 2,3, les axones sectionnés dans les longues voies myélinisées du système nerveux central (SNC) ne sont capables que d'une germination avortée qui fournit peu de récupération fonctionnelle 4 ,5 . Une blessure au SNC induit des lésions tissulaires, ce qui crée des barrières à la régénération. L'une des principales barrières est la cicatrice gliale, qui se compose principalement d'astrocytes réactifs et de protéoglycanes. Les axones ne peuvent pas se régénérer au-delà de la cicatrice gliale, et ils prennent un aspect dystrophique de croissance bloquée.

Les oligodendrocytes et la myéline dégénérative ont également été identifiés comme des sources d'échec de la régénération chez les animaux 6,7, et cela a fait l'objet de nombreuses autres revues (pour des exemples, voir les références 8-10). Ici, nous examinerons brièvement le rôle de la myéline dans l'effondrement des cônes de croissance et en tant qu'inhibiteur de la régénération. Cependant, nous nous concentrerons en grande partie sur l'environnement de la cicatrice gliale et les déterminants cellulaires et moléculaires de l'échec de la régénération sur le site de la lésion du SNC, y compris une discussion sur le comportement des axones incapables de se régénérer après la lésion. Nous conclurons l'examen en examinant les stratégies possibles pour améliorer les capacités de régénération du SNC.

La cicatrice gliale et sa formation

Dans les lésions qui épargnent la DURA MATER, la cicatrice est principalement composée d'astrocytes, mais dans les lésions plus sévères qui ouvrent les méninges, l'astroglie se mélange à des éléments envahissants du tissu conjonctif 11,12,13,14,15 (Fig. 1). La réponse des astrocytes à une blessure est appelée gliose réactive (plus de glie) mais en fait, dans la plupart des types de blessure, la quantité réelle de division des cellules gliales est relativement faible et confinée à la pénombre immédiate entourant le noyau de la lésion 16 . Beaucoup plus de la réponse gliale réactive aux blessures est l'hypertrophie avec une production accrue de FILAMENTS INTERMÉDIAIRES 17,18. On peut identifier les astrocytes réactifs hypertrophiques par des méthodes immunocytochimiques qui révèlent des augmentations de l'expression de la protéine acide fibrillaire gliale (GFAP) 19,20,21, ainsi que d'autres protéines de filaments intermédiaires, telles que la vimentine (examinée par Yang 22). L'identification d'astrocytes réactifs agrandis et enchevêtrés entourant les boules terminales dystrophiques aux extrémités des fibres non régénérantes a conduit à l'idée que la glie réactive est responsable de l'échec de la régénération par la formation d'une paroi physique. En effet, la cicatrice gliale se développe en une membrane caoutchouteuse, tenace, bloquant la croissance, mais cela prend un temps considérable (Fig. 2).

Dans tous les exemples, les macrophages envahissent la lésion et les protéoglycanes sulfate de chondroïtine (CSPG) et les protéoglycanes sulfate de kératane (KSPG) sont régulés positivement. une | Microlésion dans laquelle l'alignement des astrocytes n'est pas altéré par le processus de lésion, mais les axones sont incapables de se régénérer au-delà du site de la lésion. b | Blessure contagieuse qui ne perturbe pas les méninges, mais produit une cavitation et un dépôt de protéoglycanes. Encore une fois, les axones sont incapables de se régénérer au-delà de la lésion, mais des axones épargnés peuvent être trouvés en aval du site de la lésion. c | Lésion en coup de couteau qui pénètre les méninges et permet l'invasion des fibroblastes en plus des macrophages. Les axones sont fortement repoussés par le gradient croissant des CSPG et KSPG. Plusieurs autres molécules inhibitrices sont également fabriquées dans ce type de lésion et sont particulièrement présentes au cœur de la lésion. ECM, matrice extracellulaire TGF, facteur de croissance transformant.

une | Coupe sagittale de la moelle épinière illustrant l'hypertrophie des astrocytes (rouge) et la régulation à la hausse du protéoglycane sulfate de chondroïtine (CSPG) (bleu, indiqué par des lignes pointillées). Notez les bandes longitudinales épaissies d'astrocytes réactifs formant une paroi cellulaire extrêmement dense. b | Grossissement élevé des astrocytes réactifs en bandes, démontrant davantage l'hypertrophie extrême de l'astroglie à ce moment tardif après la lésion. c | Un grossissement élevé de la région de la lésion illustre clairement la présence de CSPG restant, ainsi que la bande fibreuse des astrocytes réactifs. | Les axones en régénération d'un ganglion de la racine dorsale microtransplanté (flèche) peuvent se développer presque partout dans la zone de dégénérescence wallérienne et de gliose réactive (rouge) rostrale à la lésion, même neuf mois après la blessure. Cependant, les axones en repousse sont exclus d'une zone d'astrocytes réactifs fibreux extrêmement denses (à droite de la flèche). Notez le manque de protéoglycanes dans cette région de la cicatrice. Cette forme de répulsion axonale semble être causée par les contraintes mécaniques du tissu réactif. EHG, glie extrêmement hypertrophique.

En plus d'empêcher la régénération, des preuves récentes indiquent que la cicatrice gliale pourrait fournir plusieurs fonctions bénéfiques importantes pour stabiliser les tissus fragiles du SNC après une blessure. Le laboratoire Sofroniew 16,23, a utilisé une technique combinatoire ingénieuse, impliquant l'infection virale de l'herpès simplex aviaire des astrocytes de mammifères et l'administration de gancyclovir, pour produire une déplétion ciblée de la sous-population d'astrocytes réactifs qui subissent une mitose entourant immédiatement le noyau de la lésion. Leurs résultats ont indiqué qu'après une blessure, ce composant de la cicatrice gliale sert à réparer la barrière hémato-encéphalique (BHE), à prévenir une réponse inflammatoire écrasante et à limiter la dégénérescence cellulaire. Ainsi, il est maintenant clair que l'un des rôles de la cicatrice gliale est d'isoler le site de la lésion des tissus sains, empêchant ainsi une vague en cascade de lésions tissulaires incontrôlées 16 . Malheureusement, bien que le bénéfice de la cicatrisation gliale soit important pour la survie globale de l'animal, les espèces à sang chaud ont largement sacrifié la capacité de régénération fonctionnelle à longue distance.

La formation de la cicatrice gliale se produit après l'introduction de molécules non-SNC dans le parenchyme cérébral à la suite d'une perturbation de la BHE 24 . La BHE reste poreuse aux composants sanguins et sériques jusqu'à 14 jours après une lésion cérébrale ou médullaire, et les zones de plus grande cicatrisation gliale sont bien corrélées avec les zones de dégradation de la BHE la plus étendue, ainsi qu'avec le plus grand nombre de MACROPHAGES activés. Des techniques de microinjection minimalement invasives 25, utilisant une préparation de paroi de levure non toxique connue sous le nom de Zymosan pour stimuler de manière focale et agressive les macrophages, ont produit une migration rapide des astrocytes loin du foyer inflammatoire, et ont également provoqué une cavitation du SNC, des cicatrices gliales et une régulation à la hausse intense des protéoglycanes autour de la cavité. De plus, la migration des astrocytes in vitro a entraîné un étirement des axones secondaires et une axotomie dans la région de l'inflammation, en raison d'associations neurones-glies aberrantes. Ces études indiquent que le sang (ou un composant sérique), ainsi que les macrophages activés, jouent un rôle crucial dans l'axotomie secondaire, ainsi que dans la régulation positive des composants inhibiteurs de la matrice extracellulaire (MEC) et d'autres phénomènes liés à la formation de la cicatrice gliale.

La recherche de l'inducteur moléculaire initial de la gliose inhibitrice se poursuit. L'un des déclencheurs potentiels les plus intéressants est le facteur de croissance transformant β (TGFβ). Dans le cerveau et la moelle épinière lésés, l'expression de TGFβ1 augmente immédiatement après la blessure, tandis que l'expression de TGFβ2 augmente plus lentement près de la plaie dans les astrocytes, les cellules endothéliales et les macrophages 26 . Il a été démontré que le TGFβ2 augmente de manière significative la production de protéoglycanes par l'astroglie 27 . Lorsque l'activité TGFβ1 et TGFβ2 est atténuée expérimentalement à l'aide d'anticorps 28, la cicatrisation gliale est réduite. Cependant, cela se produit sans réduction de l'invasion des macrophages et est insuffisant pour permettre une régénération à longue distance.

Une autre famille candidate d'inducteurs de cicatrice est les INTERLEUKINS. L'injection d'interleukine 1, une protéine produite par les phagocytes mononucléés, aide à initier la réponse inflammatoire dans diverses cellules, dont les astrocytes, qui prennent l'état réactif 29 . Ainsi, TGFβ1 et 2 et l'interleukine 1 ont été impliqués en tant que médiateurs de la cicatrisation gliale induite par les macrophages, mais d'autres facteurs pourraient également être impliqués.

Les interactions entre deux CYTOKINES inflammatoires - l'interféron-γ (IFNγ) et le facteur de croissance basique des fibroblastes 2 (FGF2) - ont également un rôle dans l'induction de la cicatrice gliale. En culture, la prévention de l'activité de l'IFNγ réduit les effets mitogènes des lymphocytes T activés, et l'ajout d'IFNγ recombinant induit la prolifération des astrocytes 30 . De plus, l'administration d'IFNγ aux cerveaux lésés augmente l'étendue de la cicatrisation gliale. Après une blessure, les niveaux de FGF2 augmentent à la fois dans le cerveau et la moelle épinière 31,32, et il a également été démontré que FGF2 augmente la prolifération des astrocytes en culture 109 . Il a été proposé que l'IFNγ et le FGF2 se modulent mutuellement après une blessure, l'IFNγ antagonisant les effets promitogènes du FGF2 (Réf. 33). Cependant, il convient de rappeler qu'au voisinage de l'extravasation de la BHE, une grande partie de la cicatrice gliale se forme sans prolifération d'astrocytes. Au lieu de cela, il y a un passage à l'état réactif, suivi d'une production inhibitrice d'ECM et d'une hypertrophie 34 . Bien que nous commencions à comprendre le rôle complexe de l'inflammation dans l'induction de la cicatrice gliale, il reste encore beaucoup à apprendre.

La réponse des axones à la cicatrice

Lorsque les axones en régénération rencontrent l'environnement de la cicatrice gliale, des bulbes dits dystrophiques se forment, comme décrit pour la première fois par Ramón y Cajal 5 . Pendant de nombreuses années, ces bulbes de forme inhabituelle ont été considérés comme stériles et donc incapables de prolonger un cône de croissance. Les terminaisons dystrophiques peuvent prendre diverses formes bizarres, allant de petits amas globulaires à d'énormes sacs multivésiculaires 5 .

Des recherches plus récentes ont indiqué que les axones avec des terminaisons dystrophiques ne perdent pas leur capacité à se régénérer et qu'ils peuvent en fait revenir à des états de croissance actifs. Les axones chroniquement blessés de la moelle épinière peuvent se régénérer en greffes nerveuses périphériques implantées après quatre semaines de stagnation dans l'environnement de la lésion 35 . Plus important encore, même dans les lésions d'un an des VOIES RUBROSPINALES adultes, les cellules qui sont traitées à proximité de leur corps avec le facteur neurotrophique dérivé du cerveau (BDNF) peuvent restaurer la taille de leur soma 36 et obtenir une nouvelle croissance axonale. dans des greffes de nerfs périphériques avec une régulation positive associée de la protéine associée à la croissance GAP43 (Réf. 37).Li et Raisman 4 ont examiné les terminaisons dystrophiques dans le contexte d'une lésion chronique. Ils ont constaté que même 13 semaines après la blessure, il y avait une persistance de grandes varices et de bulbes enflés qui ressemblaient à la fin dystrophique classique. De plus, même à ces longues périodes après la blessure, des terminaisons dystrophiques supposées stériles étaient capables de germer, et de nombreuses pousses étaient myélinisées par la migration des cellules de Schwann qui envahissent lentement le SNC à travers les zones d'entrée des racines endommagées.

Des travaux supplémentaires de Houle et Yin ont soigneusement examiné l'étendue de la rétraction axonale après une lésion de la moelle épinière 38 . L'hémisection du cordon cervical a entraîné la formation de nombreux bulbes dystrophiques. Des études antérieures ont indiqué qu'un dépérissement considérable se produit, mais en utilisant des techniques de traçage plus modernes, Houle et Yin ont montré que la plupart de ces terminaisons restaient en fait proches du site de la lésion.

L'importance de la persistance de ces « cônes de croissance » inhabituels dans l'épicentre de la lésion implique qu'un certain type de plasticité cytosquelettique et/ou membranaire doit se produire pour maintenir la viabilité et la stabilité des axones, même si les axones restent au même endroit sans former de synapses . Des travaux récents dans notre laboratoire ont commencé à élucider, à la fois en culture et en in vivo, le comportement des terminaisons dystrophiques 39 . En utilisant un gradient spécialement conçu d'aggrécane et de LAMININE comme substrat de croissance, des terminaisons dystrophiques de forme classique peuvent être induites dans les neurones adultes du GANGLION DORSAL ROOT GANGLION (DRG) alors que les fibres luttent contre le gradient. L'analyse en accéléré a révélé le fait surprenant que les terminaisons « dystrophiques » sont des structures très actives. Bien qu'ils puissent rester stationnaires pendant des jours, ils retournent constamment leurs membranes distales, modifient leur cytosquelette et modifient l'emplacement de leur complément de récepteurs d'intégrine. Pourquoi ou comment ils le font n'est pas clair, mais cela peut se produire en réponse à certains types de gradients de protéoglycanes. Nous avons la preuve que ces phénomènes dynamiques se produisent également in vivo, il est donc possible que le neurone sensoriel adulte utilise cette forme de cône de croissance aberrante pour se maintenir dans un environnement hostile.

En plus de la dystrophie, les cônes de croissance peuvent subir une autre croissance bloquée, appelée effondrement. L'effondrement du cône de croissance se produit après une blessure lorsque les axones matures en régénération rencontrent des oligodendrocytes matures et des produits de myéline 40 , et il peut également se produire normalement pendant le développement lorsque les axones se déplacent d'un substrat de croissance à un autre 41 . L'effondrement du cône de croissance a été bien caractérisé en culture cellulaire 42,43,44,45 et entraîne un ralentissement de la progression vers l'avant avec un cône de croissance rétréci et au repos qui peut redémarrer avec le temps, pour s'effondrer à nouveau après un nouveau contact avec l'agent qui s'effondre. Les cônes de croissance matures conservent leur morphologie et leur extension sur leur substrat de support jusqu'à ce qu'un contact membrane-membrane se produise avec les oligodendrocytes ou la myéline. À ce stade, le cône de croissance s'arrête, s'effondre et se rétracte souvent. Des preuves de l'effondrement du cône de croissance ont été impliquées dans l'échec de la régénération, et les méthodes qui améliorent la régénération en bloquant les effets de la myéline seront discutées plus tard. On ne sait pas si l'effondrement des cônes de croissance se produit au cours des premières phases de la progression des événements qui conduisent à la dystrophie des cônes de croissance, mais il est clair que les deux phénomènes sont remarquablement différents. Une caractéristique importante des axones dystrophiques est qu'ils peuvent être stimulés pour se régénérer, comme discuté précédemment dans le texte.

Inhibition de la cicatrice gliale : protéoglycanes

En plus des molécules favorisant la croissance 46,47, les astrocytes produisent une classe de molécules connues sous le nom de protéoglycanes 48,49. Ces molécules d'ECM sont constituées d'un noyau protéique lié par quatre fragments de sucre à une chaîne GLYCOSAMINOGLYCAN (GAG) sulfaté qui contient des unités disaccharidiques répétitives. Les astrocytes produisent quatre classes de protéoglycanes protéoglycanes sulfate d'héparane (HSPG), de protéoglycanes sulfate de dermatane (DSPG), de protéoglycanes sulfate de kératane (KSPG) et de protéoglycanes sulfate de chondroïtine (CSPG) 50 . Les CSPG forment une famille relativement importante, qui comprend l'aggrecan, le brevican, le neurocan, le NG2, le phosphacan (parfois classé comme KSPG) et le versican, qui ont tous des chaînes latérales de sulfate de chondroïtine. Ils diffèrent par le noyau protéique, ainsi que par le nombre, la longueur et le schéma de sulfatation des chaînes latérales 51,52,53. L'expression de ces CSPG augmente dans la cicatrice gliale dans le cerveau et la moelle épinière des animaux matures 54,55,56.

Les protéoglycanes ont été impliqués comme barrières à l'extension des axones du SNC dans la plaque de toit en développement de la moelle épinière 57,58, dans la ligne médiane du rhombencéphale et du mésencéphale 59,60, dans la zone d'entrée de la racine dorsale (DREZ) 61 , dans le développement du motif rétinien 62,63, et au chiasma optique et au tractus optique distal 64,65. Des travaux approfondis ont démontré que les CSPG sont extrêmement inhibiteurs de l'excroissance des axones en culture. Les neurites poussant sur des bandes alternées de laminine et de laminine/aggrécane avaient une excroissance robuste sur la laminine, mais à l'interface nette entre les deux surfaces, les cônes de croissance se sont rapidement détournés (contrairement à leur comportement bloqué dans un gradient, voir ci-dessus). La nature inhibitrice des voies contenant des protéoglycanes peut repousser les axones embryonnaires et adultes, et l'effet peut durer plus d'une semaine in vitro. Le comportement de rotation n'est généralement pas médié par l'effondrement de l'ensemble du cône de croissance, mais plutôt par la rétraction sélective de FILOPODIA en contact avec CSPG et une motilité accrue de ceux sur la laminine 66,67. Les CSPG sont de puissants inhibiteurs d'une grande variété d'autres molécules favorisant la croissance, y compris la fibronectine et L1 (Réfs 68, 69).

Au début des années 1990, la première preuve a émergé que les CSPG pourraient avoir un rôle dans l'échec de la régénération dans le SNC après une blessure. Chez les mammifères matures, les CSPG sont sécrétées rapidement (dans les 24 heures) après une blessure et peuvent persister pendant plusieurs mois 54,55,56. Il a été montré que les CSPG sont produits en excès par les astrocytes lorsqu'ils sont induits à devenir réactifs. in vivo après de petites lésions de la DREZ 61 . Les CSPG régulés à la hausse étaient présents au bon moment et au bon endroit pour empêcher la régénération des axones sensoriels dans les colonnes dorsales ou à travers la DREZ. À l'exception de ces quelques endroits dans l'hypothalamus où la régénération peut se produire chez TANYCYTES 70, les CSPG sont maintenant connus pour être régulés à la hausse et excrétés de manière extracellulaire après un large éventail de lésions du SNC 21,71,72. Il est important de noter que les astroglies réactives embryonnaires de la période pré-critique ne régulent pas à la hausse les CSPG après une blessure 73,74 (encadré 1), et il y a une régulation à la hausse minimale des CSPG sur la glie réactive chez les espèces à sang froid, à l'exception des régions spéciales où la régénération ne se produit pas. 64 (Encadré 2).

Nombreuses in vitro des tests, dans lesquels les astrocytes matures ont été induits à être hautement réactifs, ont confirmé que les protéoglycanes régulés à la hausse dans l'ECM complexe qui est faite par l'astroglie réactive inhibent l'excroissance axonale 68,73,75,76. Pour démontrer davantage que la partie GAG ​​des CSPG est inhibitrice de l'excroissance des neurites, la chondroïtinase - une enzyme extraite de la bactérie Proteus vulgaris qui supprime sélectivement une grande partie de la chaîne latérale CSPG GAG et rend les CSPG moins inhibiteurs (voir plus loin dans le texte) - a été appliqué à des explants gliaux matures «cicatrices dans un plat» (voir encadré 1). Les cellules ganglionnaires rétiniennes cultivées sur les explants de cicatrice n'ont pu étendre les longs neurites qu'après le traitement enzymatique, indiquant que les CSPG étaient présents dans la cicatrice gliale et pourraient potentiellement servir d'inhibiteurs puissants de l'excroissance des neurites in vivo 77 . De plus, lorsque la laminine (qui est également produite par l'astroglie dans ces explants de cicatrices) a été bloquée avec des anticorps, les effets d'amélioration de la croissance du traitement à la chondroïtinase ont été réduits. Ces résultats indiquent que l'extension des neurites pourrait dépendre d'un équilibre entre les molécules favorisant et inhibant la croissance sur le site de la lésion, ou que les CSPG pourraient inhiber la croissance indirectement en interférant avec les effets favorisant la croissance de la laminine ou de ses récepteurs.

Réponses différentielles aux CSPG. Différentes populations de neurones répondent aux CSPG avec divers degrés de retard de croissance in vitro 78 . Des neurones DRG embryonnaires, des neurones du ganglion rétinien ou des neurones du cerveau antérieur ont été cultivés sur un gradient de laminine et de CSPG, dans lequel la concentration de CSPG a augmenté progressivement de manière progressive tandis que la concentration de laminine est restée inchangée. Les neurones ont été initialement cultivés sur la laminine seule, et la capacité de chaque population neuronale à étendre les neurites vers le haut du gradient a été analysée. Fait intéressant, tous les neurones pourraient étendre les neurites à une certaine distance du gradient. Des trois sous-types neuronaux, les cellules ganglionnaires rétiniennes pouvaient naviguer le plus loin, bien qu'elles ralentissaient considérablement leur taux de croissance à mesure qu'elles négociaient chaque étape. Non seulement ce travail montre que différentes populations de neurones répondent différemment aux CSPG, mais il montre également que les neurones sont capables de se développer sur les CSPG (en partie, grâce à leur capacité à réguler progressivement à la hausse les récepteurs de l'intégrine) jusqu'à ce qu'un seuil critique soit atteint. De plus, la microscopie time-lapse de cônes de croissance DRG adultes sur un gradient ponctuel de CSPG construit de manière plus fluide indique que les cônes de croissance peuvent s'étendre le long d'un gradient de protéoglycane jusqu'à ce qu'une région hautement inhibitrice soit atteinte, ce qui entraîne l'arrêt complet de l'extension vers l'avant. Les neurones adultes, contrairement à leurs homologues embryonnaires, cessent de croître et forment un type inhabituel de terminaison dystrophique 39 .

Dans la moelle épinière, différentes populations neuronales ont également des capacités différentielles à se régénérer en une lésion enrichie en protéoglycanes 79 . Après la blessure, les axones moteurs en régénération étaient incapables d'entrer directement dans la lésion, mais pouvaient germer dans la région adjacente à la lésion. Les neurones exprimant la sérotonine n'étaient également capables de se régénérer que jusqu'au bord de la lésion, tandis que les axones sensoriels étaient capables de pénétrer plus profondément, mais pas tout au long de la lésion. Ces résultats montrent que certains neurones ont un seuil intrinsèque plus élevé pour traiter un terrain chargé de protéoglycanes, en particulier lorsqu'ils sont présentés dans un gradient. À un certain point, cependant, généralement près de l'épicentre de la lésion, toutes les fibres en régénération deviennent dystrophiques et finalement succombent à leur environnement de plus en plus inhibiteur.

A l'autre extrême, il existe des cas dans lesquels l'extension des neurites se produit en présence de protéoglycanes. Les axones thalamocorticaux en développement traversent les zones de dépôt de CSPG dans la sous-plaque sur le chemin de leur cible, et ces axones maintiennent une trajectoire limitée aux régions riches en CSPG pendant une grande partie de leur voyage 80 . En outre, il a été démontré que les DSPG sursulfatés favorisent, bien que de manière minime, la croissance des neurites à partir des neurones hippocampiques embryonnaires 81 . Ces études indiquent que le rôle des CSPG en tant qu'inhibiteurs de croissance pourrait ne pas être un simple phénomène « tout ou rien », comme cela a été discuté à l'origine dans Snow et al 58 . Cependant, une question restait : les axones se développent-ils différemment dans les régions contenant des protéoglycanes que dans les régions où les protéoglycanes manquent ? En utilisant des concentrations relativement faibles de CSPG qui permettent une croissance intermittente des neurites sur la laminine, Snow et ses collègues 82 ont commencé à identifier les modèles de croissance des neurones sur des niveaux permissifs de CSPG normalement inhibiteurs. Fait intéressant, les axones poussant sur CSPG se sont étroitement fasciculés (comme ils le font dans la sous-plaque), mais sont revenus à un état défasciculé lorsqu'ils sont sous laminine. Ces études mettent en évidence l'importance des concentrations de protéoglycanes et de leur équilibre avec d'autres molécules au cours de leurs interactions avec les cônes de croissance, et indiquent également que des mélanges particuliers peuvent aider à réguler la structuration globale des caractéristiques de regroupement ou de ramification axonale.

Un excès de protéoglycanes empêche la régénération in vivo. Le rôle crucial de l'ECM de cicatrice inhibitrice dans l'échec de la régénération a été révélé par des expériences de microtransplantation. Les neurones sensoriels adultes qui ont été placés dans le corps calleux adulte ou la moelle épinière lésée pourraient régénérer leurs axones dans la substance blanche intacte ou en dégénérescence, à condition que des dommages minimes soient créés en plaçant les cellules loin rostrales d'une lésion. Cependant, la régénération a cessé lorsque les axones en croissance se sont approchés du voisinage de la lésion. Ici, la régulation à la hausse des protéoglycanes se produit dans un gradient décroissant, étant la plus élevée au centre de la lésion et diminuant progressivement dans la pénombre (Fig. 3). Lorsque les fibres en régénération traversent la pénombre de la lésion, elles modifient leur morphologie et sont fortement empêchées de se déplacer davantage car elles forment un nombre toujours croissant de terminaisons dystrophiques près du cœur de la cicatrice en développement 83,84 (Fig. 3). De manière assez inattendue, les neurones sensoriels adultes transplantés étaient capables d'étendre les axones rapidement et de manière robuste (à raison de 1 mm par jour) parmi les oligodendrocytes, la myéline en dégénérescence et les astrocytes qui sont intensément réactifs en raison de la DÉGÉNÉRATION WALLERIENNE qui l'accompagne. Cependant, il est important de réitérer que le site de transplantation doit être suffisamment éloigné de la lésion pour être au-delà de la zone de fuite sérique à travers la BHE rompue. Des facteurs inconnus qui extravasent dans le parenchyme du SNC semblent déclencher la régulation à la hausse intense et rapide des protéoglycanes qui se produit après une blessure (voir plus haut dans le texte).

une | Photomicrographie confocale à double balayage de neurones du ganglion de la racine dorsale (DRG) adultes transplantés (vert) étendant les axones à la périphérie, mais pas au centre, d'une lésion de la moelle épinière (L). Les axones sont présents dans les zones de dépôt de chondroïtine sulfate protéoglycane (CSPG) (bleu), mais sont incapables de traverser les régions de dépôt croissant de CSPG. b | Grossissement élevé des axones dystrophiques s'étendant à partir de neurones DRG adultes transplantés. Notez les boules caractéristiques 5 qui se forment en présence de niveaux élevés de CSPG (flèche). Barres d'échelle : une, 250 µm b, 25 um. Figure réimprimée de la Réf. 84 © Société des neurosciences.

Ainsi, nos expériences ont révélé qu'en plus des astrocytes immatures, les astroglies réactives qui sont distales à une lésion sont étonnamment favorables à la croissance, même au sein de la substance blanche prétendument inhibitrice. Bien que les mécanismes moléculaires par lesquels les astrocytes réactifs soutiennent la croissance des axones in vivo sont inconnues, des preuves récentes de notre laboratoire indiquent que la fibronectine extracellulaire et l'alignement géométrique longitudinal de l'astroglie intrafasciculaire pourraient être deux des facteurs importants 85 . La remarquable capacité de régénération distale de la lésion peut durer plusieurs mois, jusqu'à ce que les propriétés mécaniquement obstructives de l'hypertrophie gliale entrent en jeu et bloquent la régénération par des moyens plus physiques (Fig. 2).

Molécules inhibitrices supplémentaires dans la cicatrice gliale

En plus des effets inhibiteurs des CSPG, plusieurs autres molécules sont maintenant connues pour être régulées positivement au cœur de la lésion et contribuer aux effets retardateurs de croissance de la cicatrice gliale. L'une de ces molécules est la protéine sécrétée sémaphorine 3 (SEMA3), qui agit comme un chimiorépulsif grâce à son récepteur de haute affinité neuropiline 1. Après des lésions du tractus olfactif latéral 86 , du cortex 86 ou de la moelle épinière 86,87,88 , l'expression de SEMA3 augmente dans les fibroblastes qui pénètrent profondément dans la lésion, et l'expression de la neuropiline 1 augmente dans les neurones qui se projettent vers le site de la lésion. Les axones en régénération ont été exclus des zones endommagées contenant SEMA3, créant essentiellement une zone d'exclusion au cœur de la lésion. Ces résultats corrélatifs indiquent que les sémaphorines aident à empêcher la pénétration des neurites en régénération au-delà du centre des lésions du SNC contenant des fibroblastes.

Des travaux récents de Bundeson et ses collègues 89 ont également impliqué l'éphrine-B2 et son récepteur EPHB2 dans l'inhibition de la régénération après une section de la moelle épinière. Au cours du développement normal, cet appariement ligand-récepteur joue divers rôles dans la migration cellulaire, le guidage axonal et la structuration des tissus. L'interaction de ces partenaires redevient importante après une blessure, lorsque l'expression de l'éphrine-B2 augmente dans les astrocytes et que l'expression d'EPHB2 augmente dans les fibroblastes. Au début, les astrocytes et les fibroblastes se mélangent, mais ensuite, à mesure que l'expression de l'éphrine-B2 et de l'EPHB2 augmente, ils signalent une ségrégation des types cellulaires, créant des bandes de fibroblastes et d'astrocytes, et plus important encore, la structure cellulaire du soi-disant glial/mésenchyme cicatrice.

Les protéines de fente, qui sont d'importants régulateurs du guidage axonal et de la migration cellulaire (examinées par Brose et Tessier-Lavigne 90 ), sont également augmentées, ainsi que leurs récepteurs du glypican 1 91 , dans les astrocytes réactifs après une lésion corticale 92 . Ces observations ont amené les protéines Slit à être impliquées dans l'échec de la régénération. Ensemble, les protéines SEMA3, ephrin-B2 et Slit ajoutent des niveaux supplémentaires de complexité à la source de l'échec de la régénération dans le SNC adulte, en particulier après des blessures ouvertes qui permettent l'infiltration des cellules mésenchymateuses.

Surmonter l'inhibition

Modification des protéoglycanes sulfatés. Une stratégie pour surmonter les effets inhibiteurs des CSPG et pour démontrer davantage que les CSPG inhibent la régénération, consiste à les digérer par voie enzymatique. in vivo après une lésion des voies axonales. L'enzyme chondroïtinase élimine une grande partie, mais pas la totalité, de la chaîne de sucre des CSPG, laissant derrière elle le noyau protéique et le glucide souche, et la chondroïtinase est efficace pour éliminer les propriétés inhibitrices des CSPG. En fait, une seule injection de chondroïtinase dans le cerveau entraîne une diminution des niveaux de CSPG intacte qui persiste jusqu'à quatre semaines 93 .

Le traitement à la chondroïtinase après une lésion du tractus nigrostriatal a amélioré la régénération des neurones dopaminergiques vers leurs cibles souhaitées 94 . L'application intrathécale de chondroïtinase à des animaux présentant des lésions bilatérales de la colonne dorsale a entraîné une dégradation du CSPG au site de la lésion et a permis à la fois la régénération des axones moteurs sensitifs ascendants et descendants à travers et peut-être même légèrement au-delà de la lésion 95 . De plus, ce traitement a permis de récupérer certaines fonctions locomotrices et proprioceptives. Des études préliminaires supplémentaires ont montré que la digestion CSPG peut améliorer la régénération après hémisection de la moelle épinière chez le chat 96, et également après une lésion compressive de la moelle épinière de rats 97, qui est un modèle plus pertinent pour la lésion médullaire humaine typique. Dans une autre stratégie, le traitement à la chondroïtinase améliore la capacité des axones en régénération à entrer, ainsi qu'à sortir, des greffes nerveuses périphériques transplantées dans des lésions du SNC pour fournir une autoroute chargée de cellules de Schwann et un contournement possible du site de la lésion 98,99,100. Enfin, des résultats préliminaires dans notre laboratoire indiquent que la prévention de la synthèse des CSPG après une blessure en inhibant les enzymes synthétiques pour l'assemblage de la chaîne GAG ​​améliore également la régénération 101 . Ainsi, les travaux de nombreux laboratoires ont montré que l'élimination des CSPG réduit l'environnement inhibiteur de la cicatrice gliale in vivo et favorise une certaine mesure de la régénération fonctionnelle.De plus, le traitement à la chondroïtinase nous a aidés à élucider le rôle des CSPG dans l'inhibition normale de la germination synaptique dans le cortex (Encadré 3).

Il est important de noter que l'amélioration de la régénération après un traitement à la chondroïtinase n'est pas sans limites. Des travaux récents impliquant l'implantation d'une matrice de membrane basale dans la moelle épinière illustrent ce point 102 . Lorsque la matrice seule est implantée, une régénération axonale sensorielle robuste dans ce substrat se produit, mais l'ajout d'aggrécane empêche la régénération dans la matrice. Fait intéressant, lorsque l'aggrécane est pré-digéré avec de la chondroïtinase et que le noyau purifié est ajouté à la matrice, la régénération est toujours inhibée, ce qui indique que les régions du CSPG digéré qui sont laissées après la digestion restent encore quelque peu inhibitrices de la croissance des neurites. In vitro les travaux de notre laboratoire ont également démontré que la protéine et le sucre restant après le traitement à la chondroïtinase perdaient leur pouvoir inhibiteur, mais restaient quelque peu inhibiteurs de l'excroissance du processus DRG adulte 39 . De multiples régions de protéoglycanes peuvent inhiber la croissance des neurites 103 , de sorte que la digestion par la chondroïtinase pourrait ne pas supprimer tous les aspects des CSPG qui empêchent la régénération, et d'autres stratégies qui éliminent plus complètement les chaînes GAG sont souhaitables 104 .

Bloquer les effets de la myéline. En plus d'améliorer la régénération en supprimant les effets inhibiteurs des CSPG, des travaux approfondis ont montré que le blocage de Nogo, un inhibiteur de la régénération associé à la myéline, améliore la régénération 105 . Les anticorps dirigés contre le récepteur Nogo administrés dans les sites de lésions de la moelle épinière 106 ou même systémiquement 107 semblent améliorer la régénération, bien que des travaux récents 108 aient contesté s'il s'agissait d'une régénération réellement améliorée ou simplement d'une germination locale. En effet, il est maintenant suggéré que la plupart de la récupération fonctionnelle observée lorsque des inhibiteurs de la myéline sont utilisés résulte du remodelage des circuits locaux, de sorte que la récupération fonctionnelle est médiée le long des axones longs non lésés 108 . Cette proposition, en conjonction avec les travaux de notre laboratoire démontrant la repousse rapide des axones des neurones adultes en présence de matière blanche dégénérative 83,84, ainsi que les différences entre l'effondrement des cônes de croissance et la dystrophie, indique que la myéline pourrait ne pas agir fondamentalement pour inhiber régénération à longue distance. En fait, il a même été suggéré que la myéline pourrait faciliter la croissance des axones dans certaines conditions 109 .

Renforcement de la machinerie de croissance intrinsèque. L'élimination des signaux inhibiteurs extrinsèques de la cicatrice gliale avec des traitements tels que la chondroïtinase pourrait aider à la régénération, mais cela pourrait ne pas être suffisant pour une repousse à long terme. La neurotrophine 3 (NT3) ou le facteur de croissance nerveuse (NGF), lorsqu'il est administré directement aux neurones sectionnés dans les colonnes dorsales des animaux traités avec des greffes de nerf périphérique, améliore la croissance dans le greffon, à l'extrémité opposée et au-delà de la cicatrice gliale dans le tissu hôte 110 111 . L'administration de NGF exogène induit également la germination dans la lésion des colonnes dorsales écrasées 112 . L'application intrathécale ou adénovirale de NT3 ou de NGF à la DREZ lésée incite les neurones DRG à traverser la barrière du système nerveux périphérique/SNC et à pénétrer à une certaine distance dans la moelle épinière 113,114,115,116,117, où les fibres en régénération restaurent la fonction nocioceptive. Ainsi, les preuves de la moelle épinière blessée et de DREZ indiquent que la régénération des axones peut surmonter les barrières protéoglycanes après la stimulation des neurotrophines, peut-être par l'induction de gènes favorisant la croissance, offrant une stratégie thérapeutique supplémentaire.

Les propriétés intrinsèques de croissance des neurones matures peuvent être modifiées d'autres manières pour améliorer la régénération. Contrairement aux neurones matures, les neurones embryonnaires ont une grande capacité de régénération et peuvent réguler rapidement à la hausse les récepteurs de l'intégrine pour les molécules favorisant la croissance lorsqu'ils sont mélangés à de l'aggrécane inhibiteur 118 . La surexpression des intégrines par transduction virale confère aux neurones adultes une capacité de régénération améliorée, comparable à celle des jeunes neurones. Les lésions de conditionnement périphériques améliorent également la capacité des neurones du SNC à se régénérer dans un site de lésion, en partie en raison de l'augmentation des niveaux d'AMP cyclique (AMPc) dans le corps cellulaire du neurone 119 . En outre, cet effet peut être reproduit sans lésion périphérique en injectant simplement dans les corps cellulaires des neurones sensoriels de l'AMPc 120, qui agit par le biais des voies médiées par la protéine kinase A pour affecter la germination et la croissance cellulaire. Ces résultats indiquent que les voies médiées par la protéine kinase A pourraient être exploitées pour améliorer la capacité d'un neurone à surmonter les inhibiteurs de cicatrice ainsi que les inhibiteurs de myéline après une blessure.

Les CSPG dans la cicatrice gliale altèrent la croissance neuronale en signalant par la voie Rho/ROCK, et l'inhibition spécifique de la Rho GTPase améliore la croissance du processus 121,122,123 sur des substrats contenant des protéoglycanes, ainsi que sur des substrats contenant de la myéline 122. Le blocage pharmacologique de la signalisation en aval des CSPG pourrait également améliorer la régénération du SNC.

Enfin, certains états réparateurs de la cascade inflammatoire, qui doivent être différents de ceux qui influencent la formation de cicatrices gliales, pourraient également avoir des effets pro-régénérateurs sur les neurones. L'activation des macrophages (à l'extérieur du compartiment du SNC) à l'aide de Zymosan améliore la régénération des cellules ganglionnaires rétiniennes sur de courtes distances au-delà de la cicatrice gliale après une lésion du nerf optique 124 et améliore la croissance du processus de neurones DRG dans un modèle de culture de protéoglycane contenu dans la cicatrice gliale 125 . Fait intéressant, un sucre simple, le mannose, semble être un médiateur qui stimule les neurones pour augmenter leur capacité à se régénérer 126 .

Stratégies combinatoires. Des stratégies combinatoires qui tirent parti des effets pro-régénératifs de la chondroïtinase, ainsi que des stratégies qui favorisent la stimulation du potentiel de croissance intrinsèque des neurones adultes (par exemple, les neurotrophines exogènes), peuvent également être entreprises pour induire la régénération et la germination.

Les lésions de la rétine adulte qui dénervent le colliculus supérieur produisent une germination limitée de fibres non lésées. Cependant, cette germination est souvent si minime qu'elle ne suffit pas à restaurer la fonction. Tropea et ses collègues 127 ont tenté d'augmenter cette réponse de germination en traitant le colliculus supérieur avec de la chondroïtinase combinée à une stimulation du corps des cellules ganglionnaires rétiniennes par l'application de BDNF. La chondroïtinase et le BDNF ont agi en synergie pour améliorer la germination dans une plus grande mesure que l'une ou l'autre thérapie seule. De plus, des marqueurs de synaptogenèse ont également été identifiés dans les fibres nouvellement germées, démontrant le potentiel de récupération fonctionnelle. Ce travail important démontre en outre les rôles thérapeutiques potentiels de la chondroïtinase dans l'amélioration de la régénération fonctionnelle grâce à une réponse de germination, et fait allusion au potentiel des thérapies combinatoires. Il sera fascinant de savoir si la fonction restaurée par la germination ectopique dans le colliculus est bénéfique ou préjudiciable aux comportements guidés visuellement de l'animal.

Notre discussion sur la cicatrice gliale nous a amenés à conclure que pour surmonter l'environnement inhibiteur de la cicatrice gliale, les traitements devraient idéalement fournir une autoroute favorisant la croissance à travers la cavité de la lésion, améliorer intrinsèquement la capacité des neurones à s'allonger et à manipuler les inhibiteurs extrinsèques qui bloquer la croissance dans l'environnement immédiat de la cicatrice gliale. Avec cette stratégie combinatoire, il pourrait être possible d'induire une longue distance et une régénération fonctionnelle après une lésion du SNC.

Encadré 1 | Les astrocytes réactifs immatures favorisent la régénération

Les voies axonales embryonnaires chez les espèces à sang chaud ressemblent, à certains égards, aux autoroutes axonales des amphibiens, en ce qu'elles permettent également la régénération 128,129 . De plus, lorsque du tissu embryonnaire est implanté dans la moelle épinière de rats adultes, une bien meilleure intégration et régénération des tissus est obtenue 130 .

Les différences dans la capacité des axones à se régénérer chez les mammifères très jeunes et âgés semblent être dues en partie à des changements dans la réaction astrogliale aux blessures. Lorsque la nitrocellulose est empalée dans le cerveau d'animaux jeunes et âgés, il est possible de retirer les astrocytes réactifs étroitement adhérents, ainsi que d'autres cellules qui répondent à l'implant et s'y incrustent. Les tissus de la plaie qui ont réagi à la même agression, bien qu'à des âges différents, peuvent ensuite être récoltés et utilisés pour examiner l'excroissance de populations identifiées de neurones. in vitro 131 . Les neurones de l'hippocampe cultivés sur des explants de « cicatrice dans une boîte » d'animaux nouveau-nés pourraient étendre les neurites avec une vigueur beaucoup plus grande que ceux cultivés sur des explants d'animaux matures. Les résultats ont indiqué que les tissus cicatriciels des animaux plus jeunes favorisaient la croissance, tandis que les tissus cicatriciels des animaux plus âgés étaient inhibiteurs, au moins in vitro.

Des résultats similaires ont été obtenus en utilisant des astrocytes prélevés sur le nerf optique lésé. Les cellules ganglionnaires rétiniennes cultivées sur des astrocytes du nerf optique réactifs nouveau-nés ont étendu les processus sur de plus grandes distances et avec une plus grande vitesse que les cellules ganglionnaires rétiniennes cultivées sur des astrocytes réactifs adultes. En fait, les astrocytes réactifs adultes ont complètement inhibé la croissance des neurones embryonnaires et adultes in vitro, tandis que les jeunes astrocytes ont favorisé la croissance des neurones embryonnaires et adultes 132 . Fait intéressant, les astrocytes réactifs adultes 133, ainsi que les tissus cicatriciels adultes extraits 73,131, permettent la croissance des dendrites mais pas des axones in vitro. La raison de cet effet différentiel est inconnue, mais il pourrait refléter des différences de sensibilité aux molécules inhibitrices associées à la cicatrice.

In vivo des études illustrent en outre les différences entre les astrocytes immatures et matures dans le contexte d'une blessure. Les implants Millipore non traités placés dans le cerveau de souris acalleuses adultes produisent normalement des cicatrices gliales et une dégénérescence des tissus 134 . Lorsque l'implant a été placé dans de jeunes souris acalleuses, des astrocytes hautement réactifs se sont intégrés à l'implant. Néanmoins, même à l'état réactif, la glie immature a soutenu la régénération des axones calleux à travers l'implant, au moins jusqu'à la période critique. En outre, les astrocytes réactifs immatures, mais pas matures, transplantés dans des cerveaux adultes sur nitrocellulose 135, ou directement sous forme de suspensions cellulaires 136, ont supprimé la formation de cicatrices gliales et pourraient également modifier la réponse gliale de l'adulte.

Encadré 2 | Les espèces à sang froid peuvent régénérer leurs axones

Tous les vertébrés ne subissent pas le même sort d'échec de la régénération avec formation d'une cicatrice gliale inhibitrice. La preuve que la cicatrice gliale est différemment répulsive selon les espèces a été démontrée de la manière la plus convaincante par Reier, qui a montré que la régénération peut se produire directement à travers une «cicatrice» gliale chez les amphibiens 137,138. Dans ces études, le nerf optique de Xénope a été écrasé à plusieurs reprises et les tissus gliaux réactifs denses qui ont été induits ont été récoltés et transplantés près du moignon optique fraîchement sectionné d'un receveur. Les axones des cellules ganglionnaires rétiniennes en régénération étaient capables de s'étendre à travers ces tissus gliaux densément formés. En effet, la glie réactive des amphibiens (ainsi que celles des poissons 139,140) peut subir des changements plastiques après une blessure, ce qui inclut la formation d'une nouvelle membrane favorisant la croissance des axones et un arrangement en forme de canal pour guider les nouvelles fibres 141,142.

Encadré 3 | Protéoglycanes sulfate de chondroïtine (CSPG) et plasticité synaptique

Au sein du parenchyme de matière grise du cerveau et de la moelle épinière, divers protéoglycanes liés à la famille des aggrécanes pourraient former une sorte de « calfeutrage » qui encapsule les synapses 143 . L'élimination de cet aspect de la fonction inhibitrice des protéoglycanes pourrait être essentielle pour la stimulation de la germination névritique et de la plasticité synaptique. Dans les régions corticales et sous-corticales adultes, les neurones et les synapses sont entourés d'une accumulation de matrice extracellulaire (MEC) en forme de réseau qui est censée stabiliser les synapses, contrôler l'homéostasie ionique et fournir une neuroprotection (examiné par Steindler 44 et Celio et al. 145). Cette MEC, connue sous le nom de filet périneuronal, se compose principalement de CSPG 146 , qui sont produits lorsque l'animal traverse des périodes critiques de maturation du système nerveux central 147,148 . Fait intéressant, l'élevage dans l'obscurité prolonge la durée de la période critique et, à son tour, le développement du filet périneuronal, impliquant une expérience sensorielle dans la maturation du filet 148 . Au cours des périodes juvéniles de développement du cortex visuel, il existe une grande plasticité dans les connexions neuronales. À mesure que l'animal grandit et que le réseau périneuronal augmente, le potentiel de plasticité diminue et les connexions synaptiques établies au cours du développement deviennent « verrouillées ». Lorsque cela se produit, les nouvelles expériences ne modifient pas la connectivité neuronale établie, ce qui résulterait, en partie, de l'inhibition de la germination induite par le CSPG. Ceci est bénéfique, car cela confère à l'adulte une protection contre les perturbations de la connectivité fonctionnelle provoquées par une expérience aberrante. Cependant, dans d'autres cas, et surtout après une blessure, il peut être bénéfique de restaurer la plasticité. Pizzorusso et ses collègues 149 ont tenté exactement cela en traitant le cortex visuel adulte avec de la chondroïtinase. Ce traitement a en effet restauré la plasticité du cortex visuel adulte, créant le même état de plasticité que l'on trouve chez les animaux juvéniles, et a impliqué les CSPG dans la limitation de la germination dans un système sensoriel important. L'objectif ultime sera de restaurer la plasticité de la dominance oculaire et éventuellement la vision fonctionnelle chez les adultes STRABISMIQUES, autrement les animaux dépourvus de monoculaire qui ont été rendus aveugles d'un œil depuis la naissance, mais sont autorisés à mûrir pendant de longues périodes avant le traitement enzymatique.


Matériaux et méthodes

Les souris transgéniques Rag2-GFP [21] ont été aimablement fournies par le Dr M. Nussenzweig (Rockefeller University, New York, États-Unis) et ont été élevées avec des souris transgéniques HEL-Ig [19] pour générer des animaux à double Tg. Les souris transgéniques Mx-Cre [18], B1-8f [16] et 3-83κ [17] ont été croisées pour générer des animaux B1-8f/3-83κ et B1-8f/3-83κ/Mx-Cre. Chaque souris utilisée dans ces expériences portait une seule copie des allèles knock-in HC et LC Ig. Des élevages supplémentaires ont produit des animaux HEL-Ig/Mx-Cre et B1-8f/3-83κ/Rag2-GFP. Des souris Bcl-2 [24] ont été obtenues auprès de Jackson Laboratories (Bar Harbor, Maine, États-Unis). Toutes les souris ont été maintenues dans des conditions spécifiques exemptes d'agents pathogènes et étaient généralement âgées de 4 à 8 semaines au moment des expériences.

Culture IL-7 BM.

Des suspensions unicellulaires de cellules BM de souris HEL-Ig/Rag2-GFP, B1-8f/3-83κ et B1-8f/3-83κ/Mx-Cre ont été préparées comme décrit [15], et placées dans IL- 7 Culture BM [40,41,42]. Les cellules ont été cultivées à une concentration de 1,5 à 2 × 10 6 cellules/ml dans un milieu complet composé de 1:1 RPMI 1640:EHAA (Mediatech, Washington, DC, États-Unis, et Biofluids, Rockville, Maryland, États-Unis, respectivement) , 10% FBS inactivé par la chaleur (Life Technologies, Rockville, Maryland, États-Unis), L-glutamine (BioWhittaker, Walkersville, Maryland, États-Unis), pénicilline et streptomycine (Mediatech), en présence de 16 ng/ml murin recombinant IL-7 (R&D Systems, Minneapolis, Minnesota, États-Unis) pendant 5 à 7 jours. Les cellules ont ensuite été lavées et re-cultivées dans un milieu complet avec soit de l'herbimycine A (Life Technologies) soit du wortmannine (Sigma, St. Louis, Missouri, États-Unis) pendant 8 ou 24 h, soit avec de l'IFNαβ de fibroblaste de souris (Sigma) ou de l'IFNβ recombinant (Biosource, Camrillo, Californie, États-Unis) pendant 1 à 4 jours. Pour certaines expériences, des cellules IgM hi ont été purifiées à la fin de la culture d'IL-7 en utilisant le système de billes MACs (Miltenyi Biotech, Bergisch Gladbach, Allemagne). Le TAT-Cre recombinant a été utilisé comme décrit précédemment [43]. Pour le marquage CFSE, les cellules ont été incubées dans 1 × HBSS (BioWhittaker) et 3 M CFSE (Molecular Probes, Eugene, Oregon, États-Unis) pendant 5 min à 37 °C, lavées, puis cultivées en présence ou en absence d'IFNαβ pour 1 à 4 jours.

Cytométrie en flux et tri cellulaire.

Les cellules récoltées à la fin des cultures d'IL-7, d'herbimycine A, de wortmannine ou d'IFNαβ ont été colorées dans du tampon FACS (PBS contenant 2,5% de FBS et 0,2% d'azoture de sodium) avec FITC-, PE-, CYC-, APC- ou biotine -anticorps monoclonaux conjugués contre B220, IgM, IgM a , IgM b , IgD a , CD21/CD35, CD22, CD23, CD24, CD54, CD62 l, CD69, CD86, IL-7Rα, intégrine β7, PirA/B et IA /IE (BD Pharmingen, San Diego, Californie, États-Unis) ou 3-83κ (mAb S27). La coloration avec des anticorps biotinylés a été révélée par SA-PE ou SA-APC (BD Pharmingen). Dans certaines conditions de coloration, l'annexine-V-PE et/ou 7-AAD (BD Pharmingen et Calbiochem, San Diego, Californie, États-Unis) ont été utilisées pour exclure les cellules mortes. Pour le tri cellulaire, les cellules traitées avec IFNαβ ou herbimycine A ont été colorées avec IgM a -PE et B220-CYC dans un tampon de coloration (PBS contenant 10 % de FBS) et triées par FACSVantage (Becton Dickinson, Mountain View, Californie, États-Unis). Les analyses de cytométrie en flux ont été réalisées à l'aide des logiciels CellQuest (Becton Dickinson) et Flowjo (Treestar, San Carlos, Californie, États-Unis).

Analyse PCR.

L'ADN génomique a été extrait de cellules BM non triées traitées avec IFNαβ pendant 3 jours comme décrit [15,44], et de cellules BM triées traitées avec herbimycine A pendant 1 jour ou avec IFNαβ pendant 2 jours en utilisant TRIzol (Life Technologies). L'ADN génomique de l'équivalent de 40 000 cellules, ou des dilutions en série de celui-ci, a ensuite été soumis à des amplifications PCR quantitatives en utilisant des amorces spécifiques de CD14, et des amorces Vκ dégénérées et une amorce en aval de Jκ1 comme décrit [45,46], avec de légères modifications pour le Conditions PCR V-Jκ1 : 45 s à 94 °C, 1 min à 63 °C et 1,5 min à 72 °C pendant 27 ou 30 cycles [15]. Des recombinaisons RS ont été détectées avec les amorces suivantes : amorces directes VDEG1, 5′-GCGAAGCTTCCCTGATCGCTTCACAGGCAGTGG-3′ VDEG2, 5′-GCGAAGCTTCCCW GCTCGCTTCAGTGGCAGTGG-3′ et VDEG3, 5′-GCGAAGCTTCCCAKM CAGGTTCAGTGGCATGGTGACTCAGTGGCAGTGG-3′ et VDEG3, 5′-GCGAAGCTTCCCAKM CAGGTTCAGTGGCATGGTGACT3′CAACT, -3′. Les conditions de cyclage suivantes ont été utilisées : 45 s à 94 °C, 1 min à 64 °C et 1 min à 72 °C pendant 27 ou 30 cycles [23]. Des réarrangements V-Jλ ont été détectés avec : l'amorce directe, 5′-AGGCTGTTGTGACTCAGGAATCTGCA-3′, et l'amorce inverse (JN) 5′-ACTTACCTAGGACAGTGA-3′ ou (J16) 5′-ACTCACCTAGGACAGT-3′ en utilisant les conditions de cycle suivantes : 30 s à 94 °C, 1 min à 62 °C et 1,5 min à 72 °C pendant 30, 33 ou 36 cycles [47,48]. Les produits de PCR ont été résolus sur des gels d'agarose à 1 % ou 1,5 % et visualisés avec une coloration au bromure d'éthidium. La spécificité des bandes a été confirmée par hybridation Southern de transferts de nitrocellulose avec des oligonucléotides internes radiomarqués. Des cassures d'ADN double brin à l'extrémité du signal à Jκ1 ont été identifiées comme décrit [49].

L'étendue de la délétion de l'allèle B1-8f a été quantifiée à l'aide d'un test basé sur la PCR pour amplifier à travers le site loxP 3'.L'ADN génomique extrait au TRIzol (5 ng) de populations cellulaires triées a été amplifié avec : une amorce directe, 5′-GAAAGTCCAGGCTGAGCAAAACACCAC-3′ et une amorce inverse conjuguée avec du 6-FAM (Integrated DNA Technologies, Coralville, Iowa, États-Unis), 5 -GGAGACCAATAATCAGAGGGAAGAATAATA-3′. Les conditions de cycle étaient 15 cycles de 15 s à 95 °C, 30 s à 55 °C et 1 min à 72 °C, suivis de 12 autres cycles de 15 s à 89 °C, 30 s à 55 °C, et 1 min à 72°C. Le produit de PCR pour l'allèle de type sauvage avait une longueur de 295 pb, tandis que le produit de l'allèle B1-8f était de 378 pb. L'étendue de la délétion a été calculée par la perte de l'allèle B1-8f. Ces résultats ont été confirmés en utilisant la même amorce inverse avec une amorce sens en amont du site loxP 5'. Le test a été validé en utilisant des cellules Ctrl-M hi (allèle B1-8f intact à 100 %) et des cellules Cre-M lo (allèle B1-8f 100 % délété). Les produits de PCR ont été résolus par électrophorèse sur un analyseur génétique 3100 avec des normes de taille GeneScan-500 ROX (Applied Biosystems, Foster City, Californie, États-Unis). La quantification des intensités de produit a été effectuée en utilisant GeneScan Analysis 3.7 (Applied Biosystems).

Analyse de puces génétiques par microarray.

L'ARN total des cellules BM triées traitées avec l'IFNαβ ou l'herbimycine A a été extrait à l'aide de TRIzol (Life Technologies) et purifié davantage à l'aide d'un kit RNAeasy (Qiagen, Valencia, Californie, États-Unis). L'ARN total a ensuite été soumis à une synthèse d'ADNc double brin selon le protocole standard d'Affymetrix (Expression Analysis Technical Manual P/N 700218 rev. 2, Affymetrix, Santa Clara, Californie, États-Unis). Les échantillons FxD et FxE ont été collectés à partir de tris indépendants (chaque échantillon approximativement 2 × 10 5 cellules) et l'ARN total a été extrait à l'aide de TRIzol comme décrit ci-dessus. L'ARN total a ensuite été soumis à deux cycles d'amplification pour générer des sondes d'ARNc pour l'hybridation, essentiellement comme décrit [50]. Des sondes d'ARNc marquées à la biotine (générées à l'aide du kit d'étiquetage de transcription d'ARN à haut rendement, Enzo Diagnostics, Farmingdale, New York, États-Unis) ont été fragmentées chimiquement, hybridées à des matrices de sondes murines U74A et U74Av2 (Affymetrix) et numérisées à l'Université du Minnesota Biomedical Installation du Centre de génomique. Les matrices de sondes U74Av2 ont été soumises à des corrections de masque U74A, et toutes les intensités d'hybridation cibles ont été mises à l'échelle à 1 500 unités arbitraires à l'aide de Microarray Suite 5.0 (Affymetrix). Quatre tris indépendants ont été effectués pour chacun des échantillons suivants : Ctrl-M hi , Cre-M hi et Cre-M lo deux ou trois tris ont été effectués pour tous les autres échantillons. Données avec détection de jeu de sondes p-les valeurs inférieures à 0,1 ont été incluses dans l'analyse statistique et les mesures individuelles des ensembles de sondes avec détection p-les valeurs supérieures à 0,1, et/ou les valeurs d'intensité du signal 20 ou moins, ont été fixées à une valeur de 20. Nous avons effectué toutes nos analyses statistiques en utilisant MS Excel (Microsoft Office X). Pour identifier les gènes qui étaient exprimés de manière différentielle entre les populations Ctrl-M hi et Cre-M lo, nous avons utilisé l'analyse du test t de Student en supposant que les groupes d'échantillons suivaient une distribution bilatérale et avaient une variance inégale. Pour la visualisation des puces, chaque valeur d'expression a été divisée par la moyenne des valeurs d'expression pour les échantillons IgM + pertinents. Ces ratios ont été transformés en log2 l'espace, et soumis à un clustering de liaison moyenne centrée à l'aide de CLUSTER et visualisé par le logiciel TREEVIEW [51].


Croissance des bactéries : 4 phases principales

La phase de latence représente une période de croissance active au cours de laquelle les bactéries se préparent à la reproduction, synthétisant l'ADN, diverses enzymes inductibles et d'autres macromolécules nécessaires à la division cellulaire. Par conséquent, au cours de cette phase, il peut y avoir une augmentation de la taille (volume) mais pas d'augmentation du nombre de cellules. La phase de latence peut durer une heure ou plus, et vers la fin de cette phase, certaines cellules peuvent doubler ou tripler de taille.

La phase de latence est nécessaire avant le début de la division cellulaire pour diverses raisons. Si les cellules proviennent d'une ancienne culture ou d'une culture réfrigérée, il est possible que les cellules soient vieilles et dépourvues d'ATP, de cofacteurs essentiels et de ribosomes.

Si le milieu est différent de celui dans lequel la population microbienne se développait auparavant, de nouvelles enzymes seraient nécessaires aux cellules pour utiliser de nouveaux nutriments dans le milieu.

Cependant, ces carences sont comblées par les cellules pendant la phase de latence. Il s'agit donc d'une phase de latence généralement plus longue si les cellules sont prélevées sur une culture ancienne ou réfrigérée. En revanche, si les cellules sont prélevées sur une culture jeune en croissance vigoureuse (population microbienne) et ensemencées dans un milieu frais de composition identique, la phase de latence peut être courte voire absente.

2. Log ou phase de croissance exponentielle:

Les cellules bactériennes préparées pour la division cellulaire pendant la phase de latence entrent maintenant dans la phase log ou la phase de croissance exponentielle au cours de laquelle les cellules se divisent à une vitesse maximale et leur temps de génération atteint un minimum et reste constant.

La croissance dans cette phase est assez équilibrée (c.

Étant donné que le temps de génération est constant, un graphique logarithmique de croissance pendant la phase logarithmique produit une ligne presque droite. Cette phase est appelée phase log car le logarithme de la masse bactérienne augmente linéairement avec le temps, et phase de croissance exponentielle car le nombre de cellules augmente comme une fonction exponentielle de 2 n (ie 2 1 , 2 2 , 2 3 , 2 4 ,2 5 et ainsi de suite).

La phase logarithmique représente également le moment où les cellules bactériennes sont les plus actives métaboliquement, et dans la production industrielle, c'est la période d'activité et d'efficacité maximales.

3. Phase stationnaire:

Étant donné que les bactéries se développent dans un volume constant de milieu de culture discontinue et qu'aucun élément nutritif frais n'est ajouté, la croissance de la population bactérienne finit par cesser et la courbe de croissance devient horizontale. Une telle phase de croissance chez les bactéries est atteinte à un niveau de population d'environ 10 9 cellules par ml.

L'arrêt de la croissance peut être dû à l'épuisement des nutriments disponibles ou à l'accumulation de produits finaux inhibiteurs du métabolisme. L'arrêt de la croissance peut également être dû à O2 disponibilité en particulier en cas d'aérobie. L'oxygène n'est pas très soluble et peut être épuisé si rapidement que seules les cellules à la surface de la culture peuvent trouver la concentration en oxygène nécessaire pour une croissance adéquate.

Tôt ou tard, les cellules bactériennes commencent à mourir et le nombre de ces cellules équilibre le nombre de cellules nouveau-nées et la population bactérienne se stabilise. Cet état de croissance, pendant lequel le nombre total de cellules viables reste constant en raison de l'absence d'augmentation nette supplémentaire du nombre de cellules et le taux de croissance est exactement égal au taux de mortalité, est appelé phase stationnaire.

La transition entre les phases log et exponentielle et stationnaire implique une période de croissance déséquilibrée au cours de laquelle les différents composants cellulaires sont synthétisés à des rythmes inégaux. Par conséquent, les cellules de la phase stationnaire ont une composition chimique différente de celles de la phase exponentielle.

4. Phase de mort ou de déclin:

Après un certain temps, le nombre de cellules mourantes commence à dépasser le nombre de cellules nouveau-nées et donc le nombre de cellules bactériennes viables présentes dans une culture discontinue commence à diminuer.

Cette condition représente la mort de la phase de déclin qui se poursuit jusqu'à ce que la population soit réduite à une infime fraction de cellules plus résistantes, ou elle peut disparaître complètement. Comme la croissance exponentielle, la mort est également exponentielle, mais inverse, car le nombre de cellules bactériennes viables diminue de façon exponentielle.


Croissance de la tige

La croissance des plantes se produit lorsque les tiges et les racines s'allongent. Certaines plantes, en particulier celles qui sont ligneuses, augmentent également en épaisseur au cours de leur durée de vie. L'augmentation de la longueur de la pousse et de la racine est appelée croissance primaire, et est le résultat de la division cellulaire dans le méristème apical de la pousse. Croissance secondaire se caractérise par une augmentation de l'épaisseur ou de la circonférence de la plante et est causée par la division cellulaire dans le méristème latéral. La figure 4 montre les zones de croissance primaire et secondaire d'une plante. Les plantes herbacées subissent principalement une croissance primaire, avec pratiquement aucune croissance secondaire ou augmentation d'épaisseur. La croissance secondaire ou « bois » est perceptible chez les plantes ligneuses, elle se produit chez certaines dicotylédones, mais se produit très rarement chez les monocotylédones.

Figure 4. Chez les plantes ligneuses, la croissance primaire est suivie d'une croissance secondaire, ce qui permet à la tige de la plante d'augmenter en épaisseur ou en circonférence. Du tissu vasculaire secondaire est ajouté au fur et à mesure de la croissance de la plante, ainsi qu'une couche de liège. L'écorce d'un arbre s'étend du cambium vasculaire à l'épiderme.

Certaines parties de la plante, telles que les tiges et les racines, continuent de croître tout au long de la vie d'une plante : un phénomène appelé croissance indéterminée. D'autres parties de la plante, telles que les feuilles et les fleurs, présentent une croissance déterminée, qui cesse lorsqu'une partie de la plante atteint une taille particulière.

Croissance primaire

La plupart des croissances primaires se produisent aux sommets ou aux extrémités des tiges et des racines. La croissance primaire est le résultat de la division rapide des cellules dans les méristèmes apicaux à l'extrémité des pousses et des racines. L'allongement ultérieur des cellules contribue également à la croissance primaire. La croissance des pousses et des racines lors de la croissance primaire permet aux plantes de rechercher en permanence l'eau (racines) ou la lumière du soleil (pousses).

L'influence du bourgeon apical sur la croissance globale de la plante est connue sous le nom de dominance apicale, qui diminue la croissance des bourgeons axillaires qui se forment le long des côtés des branches et des tiges. La plupart des conifères présentent une forte dominance apicale, produisant ainsi la forme conique typique d'arbre de Noël. Si le bourgeon apical est retiré, les bourgeons axillaires commenceront à former des branches latérales. Les jardiniers utilisent ce fait lorsqu'ils taillent les plantes en coupant le sommet des branches, favorisant ainsi la croissance des bourgeons axillaires, donnant à la plante une forme touffue.

Croissance secondaire

L'augmentation de l'épaisseur de la tige qui résulte de la croissance secondaire est due à l'activité des méristèmes latéraux, qui font défaut chez les plantes herbacées. Les méristèmes latéraux comprennent le cambium vasculaire et, chez les plantes ligneuses, le cambium du liège (voir la figure 4).

Figure 5. Les lenticelles sur l'écorce de ce cerisier permettent à la tige ligneuse d'échanger des gaz avec l'atmosphère environnante. (crédit : Roger Griffith)

Le cambium vasculaire est situé juste à l'extérieur du xylème primaire et à l'intérieur du phloème primaire. Les cellules du cambium vasculaire se divisent et forment le xylème secondaire (trachéides et éléments vasculaires) à l'intérieur, et le phloème secondaire (éléments criblés et cellules compagnes) à l'extérieur. L'épaississement de la tige qui se produit lors de la croissance secondaire est dû à la formation de phloème secondaire et de xylème secondaire par le cambium vasculaire, ainsi qu'à l'action du liège cambium, qui forme la couche externe dure de la tige. Les cellules du xylème secondaire contiennent de la lignine, qui fournit la robustesse et la force.

Chez les plantes ligneuses, le liège cambium est le méristème latéral le plus externe. Il produit des cellules de liège (écorce) contenant une substance cireuse connue sous le nom de subérine qui peut repousser l'eau. L'écorce protège la plante contre les dommages physiques et aide à réduire la perte d'eau. Le liège cambium produit également une couche de cellules appelée phelloderme, qui pousse vers l'intérieur à partir du cambium. Le liège cambium, les cellules de liège et le phelloderme sont collectivement appelés les périderme. Le périderme se substitue à l'épiderme chez les plantes matures. Chez certaines plantes, le périderme a de nombreuses ouvertures, appelées lenticelles, qui permettent aux cellules intérieures d'échanger des gaz avec l'atmosphère extérieure (Figure 5). Cela fournit de l'oxygène aux cellules vivantes et métaboliquement actives du cortex, du xylème et du phloème.

Anneaux annuels

Figure 6. Le taux de croissance du bois augmente en été et diminue en hiver, produisant un anneau caractéristique pour chaque année de croissance. Les changements saisonniers des conditions météorologiques peuvent également affecter le taux de croissance - notez comment les anneaux varient en épaisseur. (crédit : Adrian Pingstone)

L'activité du cambium vasculaire donne naissance à des cernes annuels de croissance. Pendant la saison de croissance printanière, les cellules du xylème secondaire ont un grand diamètre interne et leurs parois cellulaires primaires ne sont pas très épaissies. C'est ce qu'on appelle le bois précoce, ou bois de printemps. Pendant la saison d'automne, le xylème secondaire développe des parois cellulaires épaissies, formant du bois tardif, ou bois d'automne, qui est plus dense que le bois précoce. Cette alternance de bois précoce et tardif est due en grande partie à une diminution saisonnière du nombre d'éléments vasculaires et à une augmentation saisonnière du nombre de trachéides. Il en résulte la formation d'un anneau annuel, qui peut être vu comme un anneau circulaire dans la section transversale de la tige (Figure 6). Un examen du nombre d'anneaux annuels et de leur nature (telle que leur taille et l'épaisseur de la paroi cellulaire) peut révéler l'âge de l'arbre et les conditions climatiques prédominantes au cours de chaque saison.


Étapes du cycle lytique

Adsorption et pénétration

Adsorption est le processus par lequel une bactérie fait entrer son ADN ou son ARN dans la cellule hôte. Ceci est étiqueté comme 1 dans l'image ci-dessus. Les capside, ou enveloppe protéique autour du génome viral, est constituée de protéines très spécifiques. Ce bouclier de protéines ne sert pas seulement à protéger les gènes viraux, il sert en quelque sorte de « clé » pour déverrouiller une cellule. La surface des protéines est façonnée pour interagir avec les protéines à la surface de la cellule hôte.

Réplication

Au cours du cycle lytique, la réplication des gènes viraux est effectuée plusieurs fois par un système cellulaire détourné. N'oubliez pas que le virus lui-même a importé peu ou pas de protéines de soutien. Ainsi, l'ADN viral doit les produire afin de détourner les processus de la cellule. Les premières protéines créées sont souvent créées lorsque la cellule lit son propre ADN et produit des protéines. Les gènes viraux se faufilent simplement dans le processus. Cela crée ce qu'on appelle protéines virales précoces.

Ces premières protéines ont des fonctions importantes (pour le virus) de réquisition de la machinerie cellulaire. Ils nettoient le programme métabolique normal de la cellule et dirigent nombre de ses activités vers la réplication de gènes viraux et la production de protéines virales. Le virus utilise les produits bruts que la cellule a assemblés (acides aminés et acides nucléiques) comme éléments constitutifs des pièces dont il a besoin.

Bien que cela puisse sembler un processus trop complexe pour un si petit génome de virus, considérez d'abord qu'il n'y a vraiment qu'une poignée de protéines. La plupart des virus ne produisent et ne codent que pour une poignée de protéines. Contrairement aux cellules, un virus n'a pas besoin des protéines complexes nécessaires pour métaboliser l'énergie. En tant que parasites obligatoires, un virus dépend de la capacité de sa cellule hôte à fournir des matières premières. Cela en fait l'une des formes les plus efficaces de réplication de l'ADN que nous connaissions.

Assemblage et libération

Au fur et à mesure que ces pièces sont construites, leurs formes évolutives naturelles les aident à se réunir correctement. Étant donné que la plupart des composants sont des protéines, ils se sont formés au cours de l'évolution pour pouvoir se réunir avec très peu d'influence extérieure. L'assemblage de nouveaux virions est une caractéristique du cycle lytique. L'autre cycle de vie viral n'inclut pas la production et l'assemblage de nouveaux virions.

De cette façon, le cycle lytique ressemble à une petite usine à virus. Toutes les parties du virus sont produites indépendamment, puis assemblées et finalement libérées dans l'environnement. Alors que l'image ci-dessus ne montre que 3 virions assemblés au stade 6, en réalité il y en aurait des millions. Comparez le cycle lytique au cycle lysogène en dessous, dans lequel 2 copies précises sont affichées après 1 division bactérienne.

1. Lequel des énoncés suivants représente le cycle lytique ?
UNE. L'ADN viral est répliqué lorsque la cellule hôte se divise.
B. Le génome viral s'empare de la cellule hôte et crée une usine à virus.
C. Le génome viral est en grande partie dormant.

2. Quel cycle de vie, le cycle lytique ou le cycle lysogène, produit le plus de virions ?
UNE. Ça dépend
B. Le cycle lytique
C. Le cycle lysogénique

3. D'après ce que vous savez maintenant du cycle lytique, pourquoi est-il si difficile d'éradiquer le rhume ?
UNE. Cela ne devrait pas être le cas !
B. Le virus change trop.
C. En ciblant les mécanismes utilisés par les virus, vous ciblez les mécanismes que chaque cellule utilise.


Formation des anneaux de croissance

Les arbres poussant dans des zones avec des différences saisonnières prononcées subissent généralement un « éveil » du cambium au début de la saison de croissance pour former l'anneau de croissance du bois et de l'écorce. La formation des anneaux de croissance a probablement évolué vers la fin de l'ère paléozoïque en réponse aux changements saisonniers de la disponibilité de l'eau. Alors que la hauteur de l'arbre est étroitement associée à la qualité du site sur lequel l'arbre pousse (c'est-à-dire le climat, le sol, la topographie et le biote), la croissance radiale est davantage liée aux conditions météorologiques de l'année en cours. Pour cette raison, la largeur des cernes de croissance a été utilisée pour fournir des informations sur les climats passés ainsi que pour dater les événements du passé. La dendroclimatologie et la dendrochronologie sont des noms donnés à ces domaines d'études. Historiquement, les anneaux de croissance (également appelés incréments de croissance) étaient appelés anneaux annuels. La compréhension moderne de la formation saisonnière du bois reconnaît maintenant que de nombreux arbres, en particulier dans les régions tropicales et subtropicales, forment des anneaux non pas sur une base annuelle mais plutôt en réponse à diverses conditions environnementales cycliques. Les anneaux de croissance sont visibles en raison des différences de types cellulaires, de caractéristiques et d'arrangement entre ces cycles. Au sein d'un anneau de croissance, les cellules responsables de la conduction de l'eau deviennent rapidement dépourvues de contenu cellulaire car elles doivent être vides et mortes à maturité fonctionnelle. Le centre creux d'une cellule s'appelle la lumière.

Les feuillus peuvent être divisés en arbres à porosité annulaire et à porosité diffuse. Chez les arbres à anneaux poreux, les vaisseaux déposés au début de la saison de croissance sont beaucoup plus gros que les vaisseaux ultérieurs déposés à la fin de la saison (ou cerne). Les arbres à porosité diffuse forment des vaisseaux d'à peu près le même diamètre radial tout au long de la saison de croissance. Une plus grande taille de vaisseau permet une conduction de l'eau plus rapide, car le taux de conduction varie avec la quatrième puissance du rayon de la lumière du vaisseau. La plupart des arbres à anneau poreux se trouvent dans les régions tempérées du nord du monde. Chez un certain nombre d'espèces, les vaisseaux sont obstrués par des excroissances cellulaires provenant des cellules vivantes environnantes. Les occlusions, appelées tyloses, peuvent survenir au cours de la première année suivant la formation des vaisseaux. Le protoplaste d'une cellule vivante adjacente prolifère à travers des zones minces dans les parois cellulaires appelées fosses. Chêne rouge (Quercus rubra) n'a pas de tylose, alors que le chêne blanc (Q. alba) c'est pourquoi le chêne blanc est utilisé pour fabriquer des fûts de whisky, tandis que le chêne rouge ne peut pas être utilisé à cette fin.

La largeur de l'accroissement annuel dépend de la qualité du sol, de la date de début et de fin de la croissance radiale pour l'année, du taux de division cellulaire et du taux et de l'ampleur de l'expansion cellulaire.Les diamètres radiaux des cellules du système axial sont généralement plus grands au printemps, car le stress hydrique est faible et la production d'hormones élevée.

Les cellules aux parois les plus épaisses marquent généralement la fin de l'anneau de croissance. Cela entraîne souvent une forte disjonction entre les cernes de croissance, car la prochaine cellule formée sera une cellule de grand diamètre et à paroi mince qui marquera l'initiation du bois initial de l'année suivante. (Les termes bois de printemps et bois d'été ne sont plus couramment utilisés car on sait maintenant que dans de nombreux endroits, la plupart du bois dit d'été est en fait formé au printemps.) Chez les espèces préformées (arbres qui contiennent toutes les aiguilles de l'année suivante dans leurs bourgeons d'hiver), commence à peu près en même temps que la croissance des pousses, mais se poursuit généralement pendant un certain temps après la fin de la croissance des pousses pour l'année. Chez les néoformeurs (arbres qui ne préforment pas toutes les feuilles de l'année suivante dans leurs bourgeons d'hiver), la formation des feuilles peut se poursuivre pendant un certain temps après la fin de la croissance en diamètre.

Dans des conditions défavorables, des variations sont observées : anneaux incomplets (discontinus), anneaux manquants (pas de bois formé dans une année donnée), faux anneaux, anneaux excentriques (surproduction d'un côté) et anneaux cannelés (surproduction en divers sites autour de la circonférence de l'anneau). Dans un arbre donné au cours d'une année donnée, toute combinaison de ces variations peut être observée de la cime à la base.

La condition normale, en particulier chez les arbres des régions tempérées, est le développement d'un seul anneau au cours de chaque saison de croissance. Les autres anneaux formés au cours de la saison sont appelés faux anneaux. Le phénomène de faux anneaux est clairement mis en évidence chez les conifères lorsque la saison de croissance normale est interrompue par des facteurs tels que la sécheresse au printemps. Au fur et à mesure que les conditions s'aggravent, les diamètres radiaux des cellules tissulaires secondaires diminuent et les parois peuvent s'épaissir, et le bois peut prendre l'apparence du bois final. Une fois les conditions de sécheresse passées, les diamètres radiaux des cellules des tissus secondaires augmenteront, créant l'apparition d'un nouvel anneau annuel. Ceci, cependant, est un faux anneau, car il existe un gradient d'épaisseur de paroi cellulaire croissante et de diamètre cellulaire décroissant au début du faux anneau et un autre gradient d'épaisseur de paroi cellulaire décroissante et de diamètre cellulaire croissant à la fin du faux anneau. anneau.

Les faux anneaux sont un défi pour la dendroclimatologie, mais ils offrent également la possibilité de tracer des modèles météorologiques sur de longues périodes de temps. Les informations sur les climats passés sont codées non seulement dans le nombre de cellules dans un anneau annuel, mais aussi dans l'épaisseur et la composition des parois cellulaires et dans les diamètres des lumières. Des complications dans la lecture de ces informations surviennent parce que l'accroissement de croissance produit par un arbre donné au cours d'une année donnée peut être de largeur inégale à différents points autour du fût et à différentes hauteurs dans l'arbre. Les anneaux de croissance classiques se trouvent dans les conifères et les feuillus à anneaux poreux, où la délimitation des anneaux de croissance est claire. Dans les feuillus tempérés à porosité diffuse et les arbres tropicaux à anneaux, les variations des cellules en réponse au temps de développement, saisonnier et chronologique peuvent obscurcir les limites des cernes.


Voir la vidéo: Kaija Koo - Tule lähemmäs beibi with lyrics (Janvier 2022).