Informations

15.2A : Transcription chez les procaryotes - Biologie


Le code génétique est un ensemble dégénéré et non chevauchant de 64 codons qui code pour 21 acides aminés et 3 codons d'arrêt.

Objectifs d'apprentissage

  • Décrire le code génétique et comment la séquence nucléotidique prescrit l'acide aminé et la séquence protéique

Points clés

  • La relation entre les séquences de bases d'ADN et la séquence d'acides aminés dans les protéines s'appelle le code génétique.
  • Il y a 61 codons qui codent pour les acides aminés et 3 codons qui codent pour la terminaison de chaîne pour un total de 64 codons.
  • Contrairement aux eukayrotes, un chromosome bactérien est un cercle fermé de manière covalente.
  • La double hélice d'ADN doit se dérouler partiellement pour que la transcription se produise ; cette région déroulée est appelée une bulle de transcription.

Mots clés

  • nucléotide: le monomère comprenant des molécules d'ADN ou d'ARN ; se compose d'une base hétérocyclique azotée qui peut être une purine ou une pyrimidine, un sucre pentose à cinq atomes de carbone et un groupe phosphate
  • acide aminé: N'importe lequel des 20 acides -aminés naturels (ayant les groupes amino et acide carboxylique sur le même atome de carbone), et une variété de chaînes latérales, qui se combinent, via des liaisons peptidiques, pour former des protéines.
  • redondance: duplication de composants, tels que les codons d'acides aminés, pour assurer la survie de l'ensemble du système en cas de défaillance de composants uniques

Le Code Génétique : Les séquences nucléotidiques prescrivent les acides aminés

Le code génétique est la relation entre les séquences de bases d'ADN et la séquence d'acides aminés dans les protéines. Les caractéristiques du code génétique comprennent :

  • Les acides aminés sont codés par trois nucléotides.
  • Il ne se chevauche pas.
  • C'est dégénéré.

Il existe 21 acides aminés génétiquement codés que l'on trouve universellement dans les espèces des trois domaines de la vie. (Il existe un 22e acide aminé génétiquement codé, Pyl, mais jusqu'à présent, il n'a été trouvé que dans une poignée d'espèces d'archées et de bactéries.) Pourtant, il n'y a que quatre nucléotides différents dans l'ADN ou l'ARN, donc un minimum de trois nucléotides est nécessaires pour coder chacun des 21 (ou 22) acides aminés. L'ensemble de trois nucléotides qui code pour un seul acide aminé est connu sous le nom de codon. Il y a 64 codons au total, 61 qui codent pour les acides aminés et 3 qui codent pour la terminaison de chaîne. Deux des codons pour la terminaison de chaîne peuvent, dans certaines circonstances, à la place coder pour des acides aminés.

La dégénérescence est la redondance du code génétique. Le code génétique est redondant, mais sans ambiguïté. Par exemple, bien que les codons GAA et GAG spécifient tous deux l'acide glutamique (redondance), aucun d'eux ne spécifie un autre acide aminé (aucune ambiguïté). Les codons codant pour un acide aminé peuvent différer dans n'importe laquelle de leurs trois positions. Par exemple, l'acide aminé acide glutamique est spécifié par les codons GAA et GAG (différence en troisième position) ; l'acide aminé leucine est spécifié par les codons UUA, UUG, CUU, CUC, CUA, CUG (différence en première ou troisième position) ; tandis que l'acide aminé sérine est spécifié par UCA, UCG, UCC, UCU, AGU, AGC (différence en première, deuxième ou troisième position). Ces propriétés du code génétique le rendent plus tolérant aux pannes pour les mutations ponctuelles.

Origine de la transcription sur les organismes procaryotes

Les procaryotes sont pour la plupart des organismes unicellulaires qui, par définition, manquent de noyaux liés à la membrane et d'autres organites. La région centrale de la cellule dans laquelle réside l'ADN procaryote est appelée région nucléoïde. Les chromosomes bactériens et archéens sont des cercles fermés de manière covalente qui ne sont pas aussi compactés que les chromosomes eucaryotes, mais qui sont néanmoins compactés car le diamètre d'un chromosome procaryote typique est plus grand que le diamètre d'une cellule procaryote typique. De plus, les procaryotes ont souvent des plasmides abondants, qui sont des molécules d'ADN circulaires plus courtes qui peuvent ne contenir qu'un ou quelques gènes et portent souvent des traits tels que la résistance aux antibiotiques.

La transcription chez les procaryotes (comme chez les eucaryotes) nécessite que la double hélice d'ADN se déroule partiellement dans la région de synthèse de l'ARN. La région de déroulement s'appelle une bulle de transcription. La transcription procède toujours du même brin d'ADN pour chaque gène, appelé brin matrice. Le produit d'ARN est complémentaire du brin matrice et est presque identique à l'autre brin d'ADN (non matrice), appelé brin sens ou brin codant. La seule différence est que dans l'ARN, tous les nucléotides T sont remplacés par des nucléotides U.

Le nucléotide sur le brin matrice d'ADN qui correspond au site à partir duquel le premier nucléotide d'ARN 5' est transcrit est appelé le nucléotide +1, ou le site d'initiation. Les nucléotides précédant, ou 5' jusqu'au site d'initiation du brin matrice reçoivent des nombres négatifs et sont désignés en amont. Inversement, les nucléotides suivant ou en 3' du site d'initiation du brin matrice sont désignés par une numérotation « + » et sont appelés nucléotides en aval.


Expliquer le processus de transcription chez les procaryotes

Les procaryotes n'ont qu'un seul type d'ARN polymérase pour la transcription de tous les types de gènes (gènes structurels et ARN). Mais différents facteurs sigma peuvent s'associer à la même enzyme centrale à différents moments pour l'expression de différents gènes. Chez E.coli, un 70 est utilisé en condition normale 8 32/8 H sous choc thermique, o 54/c N sous manque d'azote et un 28 pour les taxis chimio.

I. Initiation

La transcription est initiée par la liaison de l'holocnzyme au promoteur. Le polypeptide o (sigma) de l'holocnzyme se lie de manière lâche à une séquence du promoteur avant même l'ouverture de la double hélice d'ADN.

Ainsi, un complexe binaire lâche/fermé est formé. Après que ce complexe soit formé, la séquence adjacente de l'ADN se dénature en formant un œil ou une bulle de transcription. La dénaturation est facilitée car la région promotrice est riche en AT. Cette bulle de transcription avec l'holoenzyme liée est appelée un complexe binaire ouvert.

Le point de départ de la transcription est une purine dans 90 % des cas. Le premier et le deuxième nucléotide complémentaire des deux premiers nucléotides du brin matrice se fixent au site d'élongation de l'enzyme. Une liaison phosphodiester se forme entre ces deux ribonucléotides par une attaque hydrophile du groupe 3′ -OH du premier ribonucléotide triphosphate sur la première liaison phosphate du deuxième nucléotide afin qu'un pyrophosphate (P-P) soit libéré dans cette réaction. Xow, le complexe se compose d'un ADN partiellement dénaturé lié à l'holoenzyme ayant un di-ribonucléotide.

Ce complexe est connu sous le nom de complexe ternaire. Plus de ribonucléotides sont ajoutés sans aucun mouvement de l'holoenzyme de sorte qu'une chaîne d'ARN d'environ neuf nucléotides soit synthétisée. Lors de l'incorporation des nucléotides au stade initial, il existe la possibilité de libérer de petites chaînes d'ARN, un processus décrit comme une initiation avortée.

Un cycle d'une telle initiation avortée se produit avant que l'initiation définitive ne commence. Une fois l'initiation réussie, le facteur sigma se dissocie de l'ARN polymérase, laissant l'enzyme centrale pour l'allongement de la chaîne d'ARN. La dissociation de sigma facilite la clairance du promoteur de l'enzyme centrale de sorte qu'une autre holoenzyme puisse se lier au promoteur pour qu'un autre cycle de transcription commence.

II. Élongation

L'allongement de la chaîne d'ARN a lieu par l'ajout de ribonucléotides à l'extrémité 3 & 8242 de l'ARN de sorte que la chaîne d'ARN se développe dans la direction 5 & 8242-3 & 8242.

Chez les procaryotes, la terminaison de la transcription est provoquée par certains signaux de terminaison sur l'ADN appelés terminateurs (ce sont des séquences d'ADN). Dans E.coli, les signaux de terminaison appartiennent à deux catégories, telles que :

1. Terminateurs intrinsèques ou facteur protéique rho (r) indépendant.

2. Terminateur extrinsèque ou dépendant de rho

Dans la terminaison intrinsèque, l'ARN à son 3 & 8242-cnd contient une longue étendue de résidus U Hydrogène lié à la longue étendue de résidus A de la matrice. Dans la tige de l'ARN, il y a un tronçon de segment de portée G-C. Le segment de portée G-C entraîne la formation d'une boucle en épingle à cheveux dans la tige d'ARN. En conséquence, la faible association entre A-U dans la longue séquence de rupture de séquence de terminaison et l'ARN est libéré.

Cela se produit parce que la formation d'une boucle en épingle à cheveux dans la tige de l'ARN avant que le signal de terminaison ralentisse la transcription et, par conséquent, les liaisons dA-rU se brisent à un moment donné, libérant l'ARN de l'hybride ARN-ADN.

Dans la terminaison extrinsèque, la protéine rho est requise. C'est un facteur protéique important responsable de la terminaison de la transcription de nombreux gènes dans E. coli. Cette protéine est active en tant qu'hexamère (ayant six sous-unités identiques). Il a un poids moléculaire de 46 000 et possède également une activité d'hydrolyse de l'ATP. Le facteur Rho se lie à l'extrémité 5 de l'ARNm naissant et descend le long de l'ARNm jusqu'à ce qu'il atteigne le point de terminaison. Au point de terminaison, lorsque la transcription ralentit, rho brise l'ATP et utilise cette énergie pour dénaturer l'hybride ARN-ADN afin que l'ARN soit libéré de la bulle.

Chez les procaryotes, comme de nombreux gènes structuraux sont présents de manière contiguë et sont transcrits ensemble, l'ARNm transcrit est polycistronique.


15.2 Transcription procaryote

À la fin de cette section, vous serez en mesure d'effectuer les opérations suivantes :

  • Lister les différentes étapes de la transcription procaryote
  • Discuter du rôle des promoteurs dans la transcription procaryote
  • Décrire comment et quand la transcription est terminée

Les procaryotes, qui comprennent les bactéries et les archées, sont pour la plupart des organismes unicellulaires qui, par définition, manquent de noyaux liés à la membrane et d'autres organites. Un chromosome bactérien est un cercle fermé qui, contrairement aux chromosomes eucaryotes, n'est pas organisé autour de protéines histones. La région centrale de la cellule dans laquelle réside l'ADN procaryote est appelée région nucléoïde. De plus, les procaryotes ont souvent des plasmides abondants, qui sont des molécules d'ADN circulaires plus courtes qui peuvent ne contenir qu'un ou quelques gènes. Les plasmides peuvent être transférés indépendamment du chromosome bactérien au cours de la division cellulaire et portent souvent des traits tels que ceux impliqués dans la résistance aux antibiotiques.

La transcription chez les procaryotes (et chez les eucaryotes) nécessite que la double hélice d'ADN se déroule partiellement dans la région de synthèse de l'ARNm. La région de déroulement s'appelle une bulle de transcription. La transcription procède toujours du même brin d'ADN pour chaque gène, appelé brin matrice. Le produit d'ARNm est complémentaire du brin matrice et est presque identique à l'autre brin d'ADN, appelé brin non-matrice, ou brin codant. La seule différence entre les nucléotides est que dans l'ARNm, tous les nucléotides T sont remplacés par des nucléotides U (figure 15.7). Dans une double hélice d'ARN, A peut se lier à U via deux liaisons hydrogène, tout comme dans l'appariement A-T dans une double hélice d'ADN.

La paire de nucléotides dans la double hélice d'ADN qui correspond au site à partir duquel le premier nucléotide d'ARNm 5' est transcrit est appelée le site +1, ou le site d'initiation. Les nucléotides précédant le site d'initiation sont indiqués par un « - » et sont désignés nucléotides en amont. Inversement, les nucléotides suivant le site d'initiation sont notés avec une numérotation "+" et sont appelés nucléotides en aval.

Initiation de la transcription chez les procaryotes

Les procaryotes n'ont pas de noyaux enfermés dans une membrane. Par conséquent, les processus de transcription, de traduction et de dégradation de l'ARNm peuvent tous se produire simultanément. Le niveau intracellulaire d'une protéine bactérienne peut être rapidement amplifié par de multiples événements de transcription et de traduction qui se produisent simultanément sur la même matrice d'ADN. Les génomes procaryotes sont très compacts et les transcrits procaryotes couvrent souvent plus d'un gène ou cistron (une séquence codant pour une seule protéine). Les ARNm polycistroniques sont ensuite traduits pour produire plus d'un type de protéine.

Notre discussion ici illustrera la transcription en décrivant ce processus dans Escherichia coli, une espèce eubactérienne bien étudiée. Bien que certaines différences existent entre la transcription dans E. coli et la transcription dans les archées, une compréhension de E. coli La transcription peut être appliquée à pratiquement toutes les espèces bactériennes.

ARN polymérase procaryote

Les procaryotes utilisent la même ARN polymérase pour transcrire tous leurs gènes. Dans E. coli, la polymérase est composée de cinq sous-unités polypeptidiques, dont deux sont identiques. Quatre de ces sous-unités, notées ??, ??, ??, et ??', comprennent l'enzyme centrale de la polymérase . Ces sous-unités s'assemblent à chaque fois qu'un gène est transcrit et se désassemblent une fois la transcription terminée. Chaque sous-unité a un rôle unique, les deux ??-les sous-unités sont nécessaires pour assembler la polymérase sur l'ADN le ??-sous-unité se lie au ribonucléoside triphosphate qui fera partie de la molécule d'ARNm naissante et de la ??La sous-unité ' se lie au brin matrice d'ADN. La cinquième sous-unité, ??, n'est impliqué que dans l'initiation de la transcription. Il confère une spécificité transcriptionnelle telle que la polymérase commence à synthétiser l'ARNm à partir d'un site d'initiation approprié. Sans ??, l'enzyme centrale se transcrirait à partir de sites aléatoires et produirait des molécules d'ARNm qui spécifiaient du charabia protéique. La polymérase composée des cinq sous-unités est appelée l'holoenzyme.

Promoteurs procaryotes

Un promoteur est une séquence d'ADN sur laquelle la machinerie de transcription, y compris l'ARN polymérase, se lie et initie la transcription. Dans la plupart des cas, les promoteurs existent en amont des gènes qu'ils régulent. La séquence spécifique d'un promoteur est très importante car elle détermine si le gène correspondant est transcrit tout le temps, parfois ou rarement. Bien que les promoteurs varient parmi les génomes procaryotes, quelques éléments sont conservés au cours de l'évolution dans de nombreuses espèces. Aux régions -10 et -35 en amont du site d'initiation, il y a deux séquences consensus du promoteur, ou des régions qui sont similaires pour tous les promoteurs et pour diverses espèces bactériennes (Figure 15.8). La séquence -10, appelée région -10, a la séquence consensus TATAAT. La séquence -35 a la séquence consensus TTGACA. Ces séquences consensus sont reconnues et liées par ??. Une fois cette interaction réalisée, les sous-unités de l'enzyme centrale se lient au site. La région -10 riche en A–T facilite le déroulement de la matrice d'ADN et plusieurs liaisons phosphodiester sont créées. La phase d'initiation de la transcription se termine par la production de transcrits abortifs, qui sont des polymères d'environ 10 nucléotides qui sont fabriqués et libérés.

Lien vers l'apprentissage

Regardez cette animation MolecularMovies pour voir le processus de transcription tel qu'il se déroule dans la cellule.

Allongement et terminaison chez les procaryotes

La phase d'élongation de la transcription commence par la libération du ?? sous-unité de la polymérase. La dissociation de ?? permet à l'enzyme centrale de procéder le long de la matrice d'ADN, synthétisant l'ARNm dans la direction 5' à 3' à une vitesse d'environ 40 nucléotides par seconde. Au fur et à mesure que l'allongement progresse, l'ADN est continuellement déroulé devant l'enzyme centrale et rembobiné derrière elle. L'appariement des bases entre l'ADN et l'ARN n'est pas suffisamment stable pour maintenir la stabilité des composants de synthèse de l'ARNm. Au lieu de cela, l'ARN polymérase agit comme un lieur stable entre la matrice d'ADN et les brins d'ARN naissants pour garantir que l'élongation n'est pas interrompue prématurément.

Signaux de terminaison procaryote

Une fois qu'un gène est transcrit, la polymérase procaryote doit recevoir l'instruction de se dissocier de la matrice d'ADN et de libérer l'ARNm nouvellement créé. Selon le gène à transcrire, il existe deux types de signaux de terminaison. L'un est à base de protéines et l'autre à base d'ARN. La terminaison Rho-dépendante est contrôlée par la protéine rho, qui suit la polymérase sur la chaîne d'ARNm en croissance. Vers la fin du gène, la polymérase rencontre une série de nucléotides G sur la matrice d'ADN et elle cale. En conséquence, la protéine rho entre en collision avec la polymérase. L'interaction avec rho libère l'ARNm de la bulle de transcription.

La terminaison indépendante de Rho est contrôlée par des séquences spécifiques dans le brin matrice d'ADN. Lorsque la polymérase approche de la fin du gène en cours de transcription, elle rencontre une région riche en nucléotides C-G. L'ARNm se replie sur lui-même et les nucléotides C-G complémentaires se lient. Le résultat est une épingle à cheveux stable qui provoque le blocage de la polymérase dès qu'elle commence à transcrire une région riche en nucléotides A-T. La région complémentaire U-A du transcrit d'ARNm ne forme qu'une faible interaction avec l'ADN matrice. Ceci, couplé à la polymérase bloquée, induit une instabilité suffisante pour que l'enzyme centrale se détache et libère le nouveau transcrit d'ARNm.

À la fin, le processus de transcription est terminé. Au moment où la terminaison se produit, le transcrit procaryote aurait déjà été utilisé pour commencer la synthèse de nombreuses copies de la protéine codée car ces processus peuvent se produire simultanément. L'unification de la transcription, de la traduction et même de la dégradation de l'ARNm est possible parce que tous ces processus se déroulent dans la même direction 5' à 3', et parce qu'il n'y a pas de compartimentation membraneuse dans la cellule procaryote (Figure 15.9). En revanche, la présence d'un noyau dans les cellules eucaryotes empêche la transcription et la traduction simultanées.

Lien vers l'apprentissage

Visitez cette animation BioStudio pour voir le processus de transcription procaryote.


Transcription chez les procaryotes

La transcription en termes simples est la synthèse d'ARN à partir d'ADN à l'aide de l'ARN polymérase. La transcription procaryote est moins compliquée que la transcription eucaryote. Ceci est également contribué par le fait que les organismes procaryotes ont une structure plutôt simple. Le noyau n'est pas défini, dépourvu d'organites membranaires et de protéines histones. Le matériel génétique procaryote contient des chromosomes bactériens ainsi que des plasmides qui portent des informations génétiques supplémentaires qui peuvent être transférées par des bactéries via des pili sexuels.

Pendant que vous rédigez un essai sur la transcription en procaryotes, assurez-vous de couvrir ces points importants.

  • Lister les différentes étapes de la transcription procaryote
  • Discuter du rôle du promoteur
  • Décrire comment et quand la transcription est terminée

Les procaryotes, y compris les bactéries et les archéobactéries, n'ont pas de noyaux et d'organites liés à la membrane, le chromosome bactérien est différent d'un eucaryote, c'est une structure fermée de manière covalente qui manque de protéines histones. Transcription signifiant la synthèse d'ARN à partir d'une matrice d'ADN à l'aide de l'ARN polymérase bactérienne. Bien que la procédure se produise à la fois chez les procaryotes et les eucaryotes, elle diffère avec l'ARN polymérase, les promoteurs et les facteurs de transcription impliqués. Chez les procaryotes, la procédure de transcription implique le déroulement partiel de l'hélice d'ADN. La région qui se déroule forme une structure en forme de bulle appelée bulle de transcription.

La paire de nucléotides sur l'hélice d'ADN qui correspond aux 5 premiers nucléotides d'ARNm est appelée le site +1 ou le site d'initiation. Les nucléotides après le site d'initiation sont numérotés avec une numérotation +. Ceux-ci sont connus sous le nom de nucléotides en aval.

crédit image

La transcription comprend les étapes suivantes

INITIATION

Chez les procaryotes, la transcription et la traduction se produisent simultanément. Avant de discuter du processus de transcription, nous devons comprendre deux facteurs importants qui aident à la transcription.

L'ARN polymérase procaryote est composée de deux sous-unités α,β, ,ω et σ. L'ensemble de ces sous-unités est connu sous le nom d'holoenzyme. Alors que α,α,β, β′,ω constituent l'enzyme de base.

Les sous-unités sont nécessaires pour assembler la polymérase sur l'ADN.

La sous-unité se lie au ribonucléoside triphosphate

La sous-unité se lie à la matrice d'ADN.

La sous-unité sigma (σ ) est la plus importante de toutes car elle joue son rôle dans l'initiation de la transcription. Il confère une spécificité transcriptionnelle afin que la polymérase puisse identifier et synthétiser l'ARNm à partir du site d'initiation uniquement si le facteur sigma s'y lie. Il est donc évident que l'absence ou l'erreur dans le facteur sigma conduit à une transcription avortée.

L'ARN polymérase ne nécessite pas d'amorce.

La transcription des procaryotes concerne deux promoteurs l'un à -10 et l'autre à -35 en amont du site d'initiation. Le promoteur en amont -10 est également connu sous le nom de boîte de Pribnow (du nom du scientifique). La région riche en AT -10 facilite également le déroulement de la matrice d'ADN. Les régions promotrices sont reconnues par le facteur sigma et aident à initier le processus de transcription.

La séquence consensus -10 est TATAAT

La séquence consensus -35 est TTGACA

ÉLONGATION

L'allongement de la transcription commence par la libération de la sous-unité sigma de la polymérase. Cette dissociation du facteur sigma permet à l'enzyme centrale de procéder le long de la matrice d'ADN en synthétisant l'ARNm dans la direction 5 & 842 à 3 & 8242 à la vitesse de 40 nucléotides/sec.


Transcription procaryote

Les procaryotes, qui comprennent les bactéries et les archées, sont pour la plupart des organismes unicellulaires qui, par définition, manquent de noyaux liés à la membrane et d'autres organites. Un chromosome bactérien est un cercle fermé de manière covalente qui, contrairement aux chromosomes eucaryotes, n'est pas organisé autour des protéines histones. La région centrale de la cellule dans laquelle réside l'ADN procaryote est appelée nucléoïde. De plus, les procaryotes ont souvent plasmides, qui sont des molécules d'ADN circulaires plus courtes qui peuvent ne contenir qu'un ou quelques gènes. Les plasmides peuvent être transférés indépendamment du chromosome bactérien au cours de la division cellulaire et portent souvent des traits tels que la résistance aux antibiotiques.

La transcription chez les procaryotes (et chez les eucaryotes) nécessite que la double hélice d'ADN se déroule partiellement dans la région de synthèse de l'ARNm. La région de déroulement est appelée bulle de transcription. La transcription procède toujours du même brin d'ADN pour chaque gène, ce qu'on appelle le brin modèle. Le produit d'ARNm est complémentaire du brin matrice et est presque identique à l'autre brin d'ADN, appelé le brin sans gabarit. La seule différence est que dans l'ARNm, tous les nucléotides T sont remplacés par des nucléotides U. Dans une double hélice d'ARN, A peut se lier à U via deux liaisons hydrogène, tout comme dans l'appariement A-T dans une double hélice d'ADN.

La paire de nucléotides dans la double hélice d'ADN qui correspond au site à partir duquel le premier nucléotide d'ARNm 5' est transcrit est appelée le site +1, ou le site d'initiation. Les nucléotides précédant le site d'initiation reçoivent des nombres négatifs et sont désignés en amont. Inversement, les nucléotides suivant le site d'initiation sont notés avec une numérotation "+" et sont appelés en aval nucléotides.

Initiation de la transcription chez les procaryotes

Les procaryotes n'ont pas de noyaux enfermés dans une membrane. Par conséquent, les processus de transcription, de traduction et de dégradation de l'ARNm peuvent tous se produire simultanément. Le niveau intracellulaire d'une protéine bactérienne peut être rapidement amplifié par de multiples événements de transcription et de traduction se produisant simultanément sur la même matrice d'ADN. La transcription procaryote couvre souvent plus d'un gène et produit des ARNm polycistroniques qui spécifient plus d'une protéine.

Notre discussion ici illustrera la transcription en décrivant ce processus dans Escherichia coli, une espèce bactérienne bien étudiée. Bien que certaines différences existent entre la transcription dans E. coli et la transcription dans les archées, une compréhension de E. coli La transcription peut être appliquée à pratiquement toutes les espèces bactériennes.

ARN polymérase procaryote

Les procaryotes utilisent la même ARN polymérase pour transcrire tous leurs gènes. Dans E. coli, la polymérase est composée de cinq sous-unités polypeptidiques, dont deux sont identiques. Quatre de ces sous-unités, notées ??, ??, ??, et ??' comprend la polymérase enzyme de base. Ces sous-unités s'assemblent à chaque fois qu'un gène est transcrit et se désassemblent une fois la transcription terminée. Chaque sous-unité a un rôle unique, les deux ??-les sous-unités sont nécessaires pour assembler la polymérase sur l'ADN le ??-sous-unité se lie au ribonucléoside triphosphate qui fera partie de la molécule d'ARNm naissante "récemment née" et de la ??' se lie au brin matrice d'ADN. La cinquième sous-unité, ??, n'est impliqué que dans l'initiation de la transcription. Il confère une spécificité transcriptionnelle telle que la polymérase commence à synthétiser l'ARNm à partir d'un site d'initiation approprié. Sans ??, l'enzyme centrale se transcrirait à partir de sites aléatoires et produirait des molécules d'ARNm qui spécifiaient du charabia protéique. La polymérase composée des cinq sous-unités est appelée la holoenzyme.

Promoteurs procaryotes

UNE promoteur est une séquence d'ADN sur laquelle la machinerie de transcription se lie et initie la transcription. Dans la plupart des cas, les promoteurs existent en amont des gènes qu'ils régulent. La séquence spécifique d'un promoteur est très importante car elle détermine si le gène correspondant est transcrit tout le temps, parfois ou rarement. Bien que les promoteurs varient parmi les génomes procaryotes, quelques éléments sont conservés. Aux régions -10 et -35 en amont du site d'initiation, il y a deux promoteurs consensus des séquences ou des régions similaires dans tous les promoteurs et dans diverses espèces bactériennes ([link]). La séquence consensus -10, appelée région -10, est TATAAT. La séquence -35, TTGACA, est reconnue et liée par ??. Une fois cette interaction réalisée, les sous-unités de l'enzyme centrale se lient au site. La région -10 riche en A–T facilite le déroulement de la matrice d'ADN et plusieurs liaisons phosphodiester sont créées. La phase d'initiation de la transcription se termine par la production de transcrits abortifs, qui sont des polymères d'environ 10 nucléotides qui sont fabriqués et libérés.

Regardez cette animation MolecularMovies pour voir la première partie de la transcription et la répétition de la séquence de bases de la boîte TATA.

Allongement et terminaison chez les procaryotes

La phase d'élongation de la transcription commence par la libération du ?? sous-unité de la polymérase. La dissociation de ?? permet à l'enzyme centrale de procéder le long de la matrice d'ADN, synthétisant l'ARNm dans la direction 5' à 3' à une vitesse d'environ 40 nucléotides par seconde. Au fur et à mesure de l'allongement, l'ADN est continuellement déroulé devant l'enzyme centrale et rembobiné derrière elle ([link]). L'appariement des bases entre l'ADN et l'ARN n'est pas suffisamment stable pour maintenir la stabilité des composants de synthèse de l'ARNm. Au lieu de cela, l'ARN polymérase agit comme un lieur stable entre la matrice d'ADN et les brins d'ARN naissants pour garantir que l'élongation n'est pas interrompue prématurément.

Signaux de terminaison procaryote

Une fois qu'un gène est transcrit, la polymérase procaryote doit recevoir l'instruction de se dissocier de la matrice d'ADN et de libérer l'ARNm nouvellement créé. Selon le gène à transcrire, il existe deux types de signaux de terminaison. L'un est à base de protéines et l'autre à base d'ARN. Terminaison Rho-dépendante est contrôlé par la protéine rho, qui suit la polymérase sur la chaîne d'ARNm en croissance. Vers la fin du gène, la polymérase rencontre une série de nucléotides G sur la matrice d'ADN et elle cale. En conséquence, la protéine rho entre en collision avec la polymérase. L'interaction avec rho libère l'ARNm de la bulle de transcription.

Résiliation indépendante de Rho est contrôlé par des séquences spécifiques dans le brin matrice d'ADN. Lorsque la polymérase approche de la fin du gène en cours de transcription, elle rencontre une région riche en nucléotides C-G. L'ARNm se replie sur lui-même et les nucléotides C-G complémentaires se lient. Le résultat est une stabilité épingle à cheveux qui provoque le blocage de la polymérase dès qu'elle commence à transcrire une région riche en nucléotides A–T. La région complémentaire U-A du transcrit d'ARNm ne forme qu'une faible interaction avec l'ADN matrice. Ceci, couplé à la polymérase bloquée, induit une instabilité suffisante pour que l'enzyme centrale se détache et libère le nouveau transcrit d'ARNm.

À la fin, le processus de transcription est terminé. Au moment où la terminaison se produit, le transcrit procaryote aurait déjà été utilisé pour commencer la synthèse de nombreuses copies de la protéine codée car ces processus peuvent se produire simultanément. L'unification de la transcription, de la traduction et même de la dégradation de l'ARNm est possible car tous ces processus se déroulent dans la même direction 5' à 3', et parce qu'il n'y a pas de compartimentation membraneuse dans la cellule procaryote ([link]). En revanche, la présence d'un noyau dans les cellules eucaryotes empêche la transcription et la traduction simultanées.

Visitez cette animation BioStudio pour voir le processus de transcription procaryote.

Résumé de la section

Chez les procaryotes, la synthèse de l'ARNm est initiée au niveau d'une séquence promotrice sur la matrice d'ADN comprenant deux séquences consensus qui recrutent l'ARN polymérase. La polymérase procaryote est constituée d'une enzyme centrale de quatre sous-unités protéiques et d'un ?? protéine qui n'aide qu'à l'initiation. L'élongation synthétise l'ARNm dans la direction 5' à 3' à une vitesse de 40 nucléotides par seconde. La terminaison libère l'ARNm et se produit soit par interaction avec la protéine rho, soit par la formation d'une épingle à cheveux d'ARNm.

Questions de révision

Quelle sous-unité du E. coli polymérase confère une spécificité à la transcription ?

Les régions -10 et -35 des promoteurs procaryotes sont appelées séquences consensus parce que ________.

  1. ils sont identiques dans toutes les espèces bactériennes
  2. ils sont similaires dans toutes les espèces bactériennes
  3. ils existent dans tous les organismes
  4. ils ont la même fonction dans tous les organismes

Réponse libre

Si l'ARNm est complémentaire du brin matrice d'ADN et que le brin matrice d'ADN est complémentaire du brin d'ADN non matrice, alors pourquoi les séquences de bases de l'ARNm et du brin d'ADN non matrice ne sont-elles pas identiques ? Pourraient-ils jamais l'être ?

L'ADN est différent de l'ARN en ce que les nucléotides T dans l'ADN sont remplacés par des nucléotides U dans l'ARN. Par conséquent, ils ne pourraient jamais être identiques dans la séquence de bases.

Dans vos propres mots, décrivez la différence entre la terminaison rho-dépendante et rho-indépendante de la transcription chez les procaryotes.

La terminaison Rho-dépendante est contrôlée par la protéine rho, qui suit la polymérase sur la chaîne d'ARNm en croissance. Près de la fin du gène, la polymérase s'arrête à une série de nucléotides G sur la matrice d'ADN. La protéine rho entre en collision avec la polymérase et libère l'ARNm de la bulle de transcription. La terminaison indépendante de Rho est contrôlée par des séquences spécifiques dans le brin matrice d'ADN. Lorsque la polymérase approche de la fin du gène en cours de transcription, elle rencontre une région riche en nucléotides C-G. Cela crée une épingle à cheveux d'ARNm qui provoque le blocage de la polymérase alors qu'elle commence à transcrire une région riche en nucléotides A-T. Parce que les liaisons A-U sont moins thermostables, l'enzyme centrale tombe.

Glossaire


TRANSCRIPTION Différence entre les procaryotes et les eucaryotes

Il s'agit d'un processus dans lequel l'information d'un brin d'ADN est copiée dans l'ARN messager (ARNm). Il décrit comment un brin d'ADN est converti en ARN (m-ARN). C'est un processus du dogme central. Pour comprendre la différence entre la transcription procaryote et eucaryote, nous devons d'abord savoir ce qu'est la transcription et comment fonctionne le processus. Vous pouvez retrouver le résumé de la transcription sur la page (Aller à la page) ….

POURQUOI LE PROCESSUS DE TRANSCRIPTION EST-IL PLUS COMPLIQUE CHEZ LES EUKARYOTES QUE LES PROKARYOTES ?

Certaines raisons par lesquelles nous pouvons différencier la transcription procaryote et eucaryote sont répertoriées ici :

  • Chez les eucaryotes, l'enveloppe nucléaire est bien développée grâce à laquelle l'ARN doit atteindre le cytoplasme à travers le nucléopore pour former des protéines.
  • Une autre complexité est la présence de trois types d'ARN.
  • *ARNm (catalysé par l'ARN polymérase 2)
  • *ARNt (catalysé par l'ARN polymérase3)
  • *ARNr (catalysé par l'ARN polymérase 1)
  • La conversion de l'ARN-Hn en ARN messager mature par le processus d'épissage, de coiffage et de queue est une autre tâche qui doit être effectuée chez les eucaryotes.
  • [L'ARN-Hn est un ARN nucléaire hétérogène].
  • Là où les procaryotes ne contiennent que 3 promoteurs différents : -10, -35 promoteur et éléments en amont, les eucaryotes contiennent différents promoteurs : éléments initiateurs, boîte TATA, boîte CAAT, éléments promoteurs.
  • Chez les procaryotes, le processus de transcription et de traduction se produit simultanément. Chez les eucaryotes 1 er l'ARN est transcrit dans le noyau et traduit dans le cytoplasme (après la transcription).
  • L'élimination chez les procaryotes effectuée par un rho-indépendant ou rho-processus dépendant. Alors que chez les procaryotes, la terminaison se produit par le signal de queue Poly A et la séquence de terminaison en aval.

Procaryotes vs Eucaryotes (Traduction)

S.NO Procaryotes Eucaryotes
1 La méthionine (l'acide aminé initiateur) doit être formulée (en raison de l'existence de deux ARNt pour la méthionine). La méthionine n'est pas formulée car il n'y a qu'un seul ARNt présent pour la méthionine.
2. Chez les procaryotes, les ribosomes arrivent à l'ARNm à AOT codon ou le site voisin de Shine-Dalgarno. Les ribosomes arrivent à l'extrémité 5' de l'ARNm.
3. Les facteurs d'initiation ne sont pas nécessaires pour créer un contact initial entre les ribosomes et l'ARNm De nombreux facteurs protéiques ainsi que l'ATP sont nécessaires pour engager l'ARNm des ribosomes.
4. De petites unités (les 30) du ribosome peuvent également engager l'ARNm avant la liaison de l'initiateur méthionine De petites unités (les 40) de ribosomes se lient à l'ARNm après que l'initiateur méthionine se lie à l'ARNt.

Le processus d'épissure du recouvrement et de la queue est un autre processus qui sera discuté plus tard.


74 Transcription procaryote

À la fin de cette section, vous serez en mesure d'effectuer les opérations suivantes :

  • Lister les différentes étapes de la transcription procaryote
  • Discuter du rôle des promoteurs dans la transcription procaryote
  • Décrire comment et quand la transcription est terminée

Les procaryotes, qui comprennent les bactéries et les archées, sont pour la plupart des organismes unicellulaires qui, par définition, manquent de noyaux liés à la membrane et d'autres organites. Un chromosome bactérien est un cercle fermé qui, contrairement aux chromosomes eucaryotes, n'est pas organisé autour de protéines histones. La région centrale de la cellule dans laquelle réside l'ADN procaryote est appelée région nucléoïde. De plus, les procaryotes ont souvent des plasmides abondants, qui sont des molécules d'ADN circulaires plus courtes qui peuvent ne contenir qu'un ou quelques gènes. Les plasmides peuvent être transférés indépendamment du chromosome bactérien au cours de la division cellulaire et portent souvent des traits tels que ceux impliqués dans la résistance aux antibiotiques.

La transcription chez les procaryotes (et chez les eucaryotes) nécessite que la double hélice d'ADN se déroule partiellement dans la région de synthèse de l'ARNm. La région de déroulement s'appelle une bulle de transcription. La transcription procède toujours du même brin d'ADN pour chaque gène, appelé brin matrice. Le produit d'ARNm est complémentaire du brin matrice et est presque identique à l'autre brin d'ADN, appelé brin non-matrice, ou brin codant. La seule différence entre les nucléotides est que dans l'ARNm, tous les nucléotides T sont remplacés par des nucléotides U ((Figure)). Dans une double hélice d'ARN, A peut se lier à U via deux liaisons hydrogène, tout comme dans l'appariement A-T dans une double hélice d'ADN.


La paire de nucléotides dans la double hélice d'ADN qui correspond au site à partir duquel le premier nucléotide d'ARNm 5 & 8242 est transcrit est appelée le site +1, ou site d'initiation. Les nucléotides précédant le site d'initiation sont indiqués par un « - » et sont désignés nucléotides en amont. Inversement, les nucléotides suivant le site d'initiation sont notés avec une numérotation "+" et sont appelés nucléotides en aval.

Initiation de la transcription chez les procaryotes

Les procaryotes n'ont pas de noyaux enfermés dans une membrane. Par conséquent, les processus de transcription, de traduction et de dégradation de l'ARNm peuvent tous se produire simultanément. Le niveau intracellulaire d'une protéine bactérienne peut être rapidement amplifié par de multiples événements de transcription et de traduction qui se produisent simultanément sur la même matrice d'ADN. Les génomes procaryotes sont très compacts et les transcrits procaryotes couvrent souvent plus d'un gène ou cistron (une séquence codant pour une seule protéine). Les ARNm polycistroniques sont ensuite traduits pour produire plus d'un type de protéine.

Notre discussion ici illustrera la transcription en décrivant ce processus dans Escherichia coli, une espèce eubactérienne bien étudiée. Bien que certaines différences existent entre la transcription dans E. coli et la transcription dans les archées, une compréhension de E. coli La transcription peut être appliquée à pratiquement toutes les espèces bactériennes.

ARN polymérase procaryote

Les procaryotes utilisent la même ARN polymérase pour transcrire tous leurs gènes. Dans E. coli, la polymérase est composée de cinq sous-unités polypeptidiques, dont deux sont identiques. Quatre de ces sous-unités, notées ??, ??, ??, et ??‘, comprennent l'enzyme centrale de la polymérase. Ces sous-unités s'assemblent à chaque fois qu'un gène est transcrit et se désassemblent une fois la transcription terminée. Chaque sous-unité a un rôle unique, les deux ??-les sous-unités sont nécessaires pour assembler la polymérase sur l'ADN le ??-sous-unité se lie au ribonucléoside triphosphate qui fera partie de la molécule d'ARNm naissante et de la ??La sous-unité ‘ se lie au brin matrice d'ADN. La cinquième sous-unité, ??, n'est impliqué que dans l'initiation de la transcription. Il confère une spécificité transcriptionnelle telle que la polymérase commence à synthétiser l'ARNm à partir d'un site d'initiation approprié. Sans ??, l'enzyme centrale se transcrirait à partir de sites aléatoires et produirait des molécules d'ARNm qui spécifiaient du charabia protéique. La polymérase composée des cinq sous-unités est appelée l'holoenzyme.

Promoteurs procaryotes

Un promoteur est une séquence d'ADN sur laquelle la machinerie de transcription, y compris l'ARN polymérase, se lie et initie la transcription. Dans la plupart des cas, les promoteurs existent en amont des gènes qu'ils régulent. La séquence spécifique d'un promoteur est très importante car elle détermine si le gène correspondant est transcrit tout le temps, parfois ou rarement. Bien que les promoteurs varient parmi les génomes procaryotes, quelques éléments sont conservés au cours de l'évolution dans de nombreuses espèces. Aux régions -10 et -35 en amont du site d'initiation, il y a deux séquences consensus du promoteur, ou des régions qui sont similaires dans tous les promoteurs et dans diverses espèces bactériennes ((Figure)). La séquence -10, appelée région -10, a la séquence consensus TATAAT. La séquence -35 a la séquence consensus TTGACA. Ces séquences consensus sont reconnues et liées par ??. Une fois cette interaction réalisée, les sous-unités de l'enzyme centrale se lient au site. La région -10 riche en A–T facilite le déroulement de la matrice d'ADN et plusieurs liaisons phosphodiester sont créées. La phase d'initiation de la transcription se termine par la production de transcrits abortifs, qui sont des polymères d'environ 10 nucléotides qui sont fabriqués et libérés.


Regardez cette animation MolecularMovies pour voir la première partie de la transcription et la répétition de la séquence de bases de la boîte TATA.

Allongement et terminaison chez les procaryotes

La phase d'élongation de la transcription commence par la libération du ?? sous-unité de la polymérase. La dissociation de ?? permet à l'enzyme centrale de procéder le long de la matrice d'ADN, synthétisant l'ARNm dans la direction 5 & 842 à 3 & 8242 à une vitesse d'environ 40 nucléotides par seconde. Au fur et à mesure que l'allongement progresse, l'ADN est continuellement déroulé devant l'enzyme centrale et rembobiné derrière elle. L'appariement des bases entre l'ADN et l'ARN n'est pas suffisamment stable pour maintenir la stabilité des composants de synthèse de l'ARNm. Au lieu de cela, l'ARN polymérase agit comme un lieur stable entre la matrice d'ADN et les brins d'ARN naissants pour garantir que l'élongation n'est pas interrompue prématurément.

Signaux de terminaison procaryote

Une fois qu'un gène est transcrit, la polymérase procaryote doit recevoir l'instruction de se dissocier de la matrice d'ADN et de libérer l'ARNm nouvellement créé. Selon le gène à transcrire, il existe deux types de signaux de terminaison. L'un est à base de protéines et l'autre à base d'ARN. La terminaison Rho-dépendante est contrôlée par la protéine rho, qui suit la polymérase sur la chaîne d'ARNm en croissance. Vers la fin du gène, la polymérase rencontre une série de nucléotides G sur la matrice d'ADN et elle cale. En conséquence, la protéine rho entre en collision avec la polymérase. L'interaction avec rho libère l'ARNm de la bulle de transcription.

La terminaison indépendante de Rho est contrôlée par des séquences spécifiques dans le brin matrice d'ADN. Lorsque la polymérase approche de la fin du gène en cours de transcription, elle rencontre une région riche en nucléotides C-G. L'ARNm se replie sur lui-même et les nucléotides C-G complémentaires se lient. Le résultat est une épingle à cheveux stable qui provoque le blocage de la polymérase dès qu'elle commence à transcrire une région riche en nucléotides A-T. La région complémentaire U-A du transcrit d'ARNm ne forme qu'une faible interaction avec l'ADN matrice. Ceci, couplé à la polymérase bloquée, induit une instabilité suffisante pour que l'enzyme centrale se détache et libère le nouveau transcrit d'ARNm.

À la fin, le processus de transcription est terminé. Au moment où la terminaison se produit, le transcrit procaryote aurait déjà été utilisé pour commencer la synthèse de nombreuses copies de la protéine codée car ces processus peuvent se produire simultanément. L'unification de la transcription, de la traduction et même de la dégradation de l'ARNm est possible parce que tous ces processus se produisent dans le même sens 5 à 3 8242 et parce qu'il n'y a pas de compartimentation membraneuse dans la cellule procaryote ((Figure)). En revanche, la présence d'un noyau dans les cellules eucaryotes empêche la transcription et la traduction simultanées.


Visitez cette animation BioStudio pour voir le processus de transcription procaryote.

Résumé de la section

Chez les procaryotes, la synthèse de l'ARNm est initiée au niveau d'une séquence promotrice sur la matrice d'ADN comprenant deux séquences consensus qui recrutent l'ARN polymérase. La polymérase procaryote est constituée d'une enzyme centrale de quatre sous-unités protéiques et d'un ?? protéine qui n'aide qu'à l'initiation. L'élongation synthétise l'ARNm dans la direction 5'8242 à 3'8242 à une vitesse de 40 nucléotides par seconde. La terminaison libère l'ARNm et se produit soit par interaction avec la protéine rho, soit par la formation d'une épingle à cheveux d'ARNm.

Questions de révision

Quelle sous-unité du E. coli polymérase confère une spécificité à la transcription ?

Les régions -10 et -35 des promoteurs procaryotes sont appelées séquences consensus parce que ________.

  1. ils sont identiques dans toutes les espèces bactériennes
  2. ils sont similaires dans toutes les espèces bactériennes
  3. ils existent dans tous les organismes
  4. ils ont la même fonction dans tous les organismes

Trois espèces de bactéries différentes ont les séquences consensus suivantes en amont d'un gène conservé.

Espèce A Espèce B Espèce C
-10 TAATAAT TTTAAT TATATT
-35 TTGACA TTGGCC TTGAAA

Ordonnez les bactéries de l'initiation la plus efficace à la moins efficace de la transcription génique.

Questions de pensée critique

Si l'ARNm est complémentaire du brin matrice d'ADN et que le brin matrice d'ADN est complémentaire du brin d'ADN non matrice, alors pourquoi les séquences de bases de l'ARNm et du brin d'ADN non matrice ne sont-elles pas identiques ? Pourraient-ils jamais l'être ?

L'ADN est différent de l'ARN en ce que les nucléotides T dans l'ADN sont remplacés par des nucléotides U dans l'ARN. Par conséquent, ils ne pourraient jamais être identiques dans la séquence de bases.

Dans vos propres mots, décrivez la différence entre la terminaison rho-dépendante et rho-indépendante de la transcription chez les procaryotes.

La terminaison Rho-dépendante est contrôlée par la protéine rho, qui suit la polymérase sur la chaîne d'ARNm en croissance. Près de la fin du gène, la polymérase s'arrête à une série de nucléotides G sur la matrice d'ADN. La protéine rho entre en collision avec la polymérase et libère l'ARNm de la bulle de transcription. La terminaison indépendante de Rho est contrôlée par des séquences spécifiques dans le brin matrice d'ADN. Lorsque la polymérase approche de la fin du gène en cours de transcription, elle rencontre une région riche en nucléotides C-G. Cela crée une épingle à cheveux d'ARNm qui provoque le blocage de la polymérase alors qu'elle commence à transcrire une région riche en nucléotides A-T. Parce que les liaisons A-U sont moins thermostables, l'enzyme centrale tombe.

Un fragment d'ADN bactérien se lit comme suit :

3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

En supposant que ce fragment soit le brin matrice, quelle est la séquence d'ARNm qui serait transcrite ? (Indice : assurez-vous d'identifier le site d'initiation.)

En examinant la séquence d'ADN, nous pouvons voir qu'il existe une séquence consensus -10 près de l'extrémité 3' du fragment. Si l'on compte ensuite en aval, le site d'initiation +1 est le T suivant immédiatement la séquence AAT. Cela signifie que le fragment d'ADN qui servira de matrice pour la transcription a la séquence TGATAGAAGCACTCTAC. L'ARNm fabriqué à partir de cette matrice aura un appariement de bases complémentaire avec l'uracile (U) au lieu de la thymine (T). Cela nous donne ACUAUCUUCGUGAGAUG comme séquence d'ARNm transcrite.

Glossaire


Transcription en procaryotes

Cet ensemble complet d'animations comprend toutes les étapes de la transcription dans l'initiation, l'élongation et la terminaison des procaryotes. L'accent est mis sur la relation structure-fonction et les interactions protéine-protéine/protéine-acide nucléique. Toutes les structures de protéines et d'acides nucléiques sont présentées à l'échelle, et toutes les interactions protéines/acides nucléiques et les changements de conformation sont décrits avec précision, sur la base des dernières recherches scientifiques. La vidéo d'initiation/d'élongation commence par une introduction à l'ARN polymérase et au facteur sigma. La liaison de sigma au promoteur est montrée avec précision, permettant aux étudiants de comprendre la relation structure-fonction entre le promoteur et l'holoenzyme.

La vidéo se poursuit avec une visualisation de la façon dont le facteur sigma charge physiquement l'ADN sur l'ARN polymérase, menant finalement au complexe ouvert. Les étudiants voient ensuite comment sigma bloque initialement le canal de sortie, leur permettant de comprendre le mécanisme derrière les transcriptions avortées. La vidéo de terminaison couvre à la fois la terminaison intrinsèque et dépendante de Rho, en se concentrant sur la façon dont les changements de conformation induits par l'ATP au sein des sous-unités Rho conduisent à la translocation de la protéine dans l'ARNm.


Initiation de la transcription chez les procaryotes

Les procaryotes n'ont pas de noyaux enfermés dans une membrane. Par conséquent, les processus de transcription, de traduction et de dégradation de l'ARNm peuvent tous se produire simultanément. Le niveau intracellulaire d'une protéine bactérienne peut être rapidement amplifié par de multiples événements de transcription et de traduction se produisant simultanément sur la même matrice d'ADN. La transcription procaryote couvre souvent plus d'un gène et produit des ARNm polycistroniques qui spécifient plus d'une protéine.

Notre discussion ici illustrera la transcription en décrivant ce processus dans Escherichia coli, une espèce bactérienne bien étudiée. Bien que certaines différences existent entre la transcription dans E. coli et la transcription dans les archées, une compréhension de E. coli La transcription peut être appliquée à pratiquement toutes les espèces bactériennes.


Chez les procaryotes, la synthèse de l'ARNm est initiée au niveau d'une séquence promotrice sur la matrice d'ADN comprenant deux séquences consensus qui recrutent l'ARN polymérase. La polymérase procaryote est constituée d'une enzyme centrale de quatre sous-unités protéiques et d'un ?? protéine qui n'aide qu'à l'initiation. L'élongation synthétise l'ARNm dans la direction 5' à 3' à une vitesse de 40 nucléotides par seconde. La terminaison libère l'ARNm et se produit soit par interaction avec la protéine rho, soit par la formation d'une épingle à cheveux d'ARNm.

Quelle sous-unité du E. coli polymérase confère une spécificité à la transcription ?