Informations

1.4.16.11 : Pourquoi c'est important - Vertébrés - Biologie


Pourquoi classer différents types de vertébrés ?

Les vertébrés sont parmi les organismes les plus reconnaissables du règne animal. Bien qu'on ne sache pas avec certitude ce qui a causé leur extinction, on en sait beaucoup sur l'anatomie des dinosaures, étant donné la préservation des éléments squelettiques dans les archives fossiles.

Actuellement, un certain nombre d'espèces de vertébrés sont menacées d'extinction principalement en raison de la perte d'habitat et de la pollution. Selon l'Union internationale pour la conservation de la nature, plus de 6 000 espèces de vertébrés sont classées menacées. Les amphibiens et les mammifères sont les classes avec le plus grand pourcentage d'espèces menacées, avec 29 pour cent de tous les amphibiens et 21 pour cent de tous les mammifères classés comme menacés. Des tentatives sont faites dans le monde entier pour empêcher l'extinction des espèces menacées. Par exemple, le Plan d'action pour la biodiversité est un programme international, ratifié par 188 pays, qui vise à protéger les espèces et les habitats.

De plus, la plupart de nos animaux de compagnie sont des vertébrés : oiseaux, serpents, chats, chiens, etc. Les êtres humains aiment leurs compagnons animaux, et il est important de les comprendre ainsi que leurs besoins.


Résolution en microscopie

00:00:11.25 La lumière elle-même a un grain intrinsèque. Et c'est-à-dire que vous pouvez prendre un
00:00:16.07 image à très haute résolution, mais si vous continuez à souffler
00:00:18.19 et en l'agrandissant de plus en plus, vous ne
00:00:21.08 obtenir plus d'informations. Et j'aimerais parler de pourquoi c'est,
00:00:26.03 car cela a limité les formes traditionnelles de microscopie
00:00:29.28 avec une limite liée à la diffraction de la lumière.
00:00:34.07 Je vais vous expliquer ce que c'est. Et cette limite de diffraction
00:00:36.17 nous conduit finalement à un point de lumière irrémédiablement petit,
00:00:41.20 qui est basé sur ce qu'on appelle la fonction d'étalement de points.
00:00:45.19 Cela limite la résolution des formes traditionnelles de microscopie.
00:00:48.22 Donc pour commencer, je pense que nous devons expliquer pourquoi la lumière ne
00:00:54.23 se comportent d'une manière qui permettrait juste un grossissement infini.
00:00:57.16 Et c'est, pour la plupart d'entre nous, toute personne qui a tenu un pointeur laser,
00:01:01.12 vous avez l'impression que la lumière voyage en ligne droite. Et
00:01:04.17 cela devrait être très simple pour comprendre où la lumière
00:01:09.19 va, et le meilleur exemple pour l'imagerie est le plus simple
00:01:14.02 de tous les appareils d'imagerie, la caméra sténopé. je veux juste te montrer
00:01:18.01 une photo d'une caméra sténopé ici. Une caméra sténopé est un
00:01:22.17 appareil qui a une boîte, et cette boîte a un trou d'épingle
00:01:29.05 dedans. Et la boîte a généralement un morceau de photographie
00:01:32.28 papier à l'intérieur de la boîte. La boite est scellée, j'ai pas montré les côtés
00:01:37.22 de la boîte. Et le papier photographique regarde le monde
00:01:41.14 et le monde est vu à travers un seul trou d'épingle.
00:01:44.10 Dans ce cas, le monde se compose d'un seul lampadaire,
00:01:47.17 comme indiqué de l'autre côté de cette image. Et l'idée du
00:01:51.24 caméra sténopé est très simple. C'est cette lumière de
00:01:54.15 chaque partie du lampadaire va dans tous les sens, mais parce que le
00:02:00.09 le trou d'épingle n'est qu'à un seul endroit, un seul rayon de lumière de chaque partie
00:02:04.04 du lampadaire passe par le trou d'épingle. Donc tout en haut de la
00:02:07.12 le lampadaire a la lumière allant dans plusieurs directions, les deux lignes pointillées
00:02:10.24 sont deux directions que la lumière voyage qui heurte le
00:02:14.04 mur de la boîte. Mais l'un des rayons, celui qui est solide
00:02:18.00 passe par le trou d'épingle et finit ici.
00:02:21.11 De même, la lumière du bas du lampadaire va dans tout
00:02:24.22 directions, mais la seule lumière qui passe à travers le trou d'épingle
00:02:27.16 est la partie qui se termine ici. Et ainsi de suite pour chaque objet
00:02:32.13 dans l'espace. Donc, si vous laissez le papier photographique à l'intérieur d'un
00:02:37.07 appareil photo à sténopé assez long, vous obtenez une très belle image
00:02:40.08 du monde. Et si c'était ainsi que la lumière agit, alors
00:02:47.05 nous devrions pouvoir faire de la très haute résolution. Parce que la lumière juste
00:02:51.01 se déplace en ligne droite, et nous devrions pouvoir étendre les objets.
00:02:54.19 Par exemple, si nous déplaçons le morceau de papier photographique
00:02:58.10 plus loin du trou d'épingle, cet objet devient plus gros et
00:03:01.20 il devrait devenir de plus en plus gros et nous devrions en avoir de plus en plus
00:03:04.08 résolution. Pour qu'en fin de compte, chaque petit fait de la vie dans
00:03:09.16 le monde réel devrait se retrouver sur ce morceau de papier. Ça tourne
00:03:12.26 dehors, cependant, qu'il y a certains problèmes avec la caméra sténopé.
00:03:17.07 Et c'est ce qui limite sa résolution, et je veux
00:03:21.09 vous donne un exemple évident. Vous pouvez voir que le trou d'épingle
00:03:24.19 étaient plus grandes, cette image deviendrait floue car il y aurait plus
00:03:29.12 qu'un rayon de lumière du haut du lampadaire qui passerait
00:03:33.26 le trou d'épingle. Et cela brouillerait l'image ici. Donc
00:03:36.21 un gros trou d'épingle ne fonctionnerait pas du tout. Et en fait, s'il n'y avait pas de trou d'épingle
00:03:40.04 du tout, vous n'obtiendriez pas une image du monde, vous auriez juste le
00:03:42.13 lumière sur ce morceau de papier. Cependant, vous pouvez imaginer que nous devrions obtenir
00:03:47.00 meilleure résolution si on baisse le trou d'épingle. Ce serait plus net
00:03:50.16 image alors que le trou d'épingle devenait de plus en plus petit, limitant
00:03:53.21 un seul rayon de lumière de chaque position d'obtenir
00:03:57.17 à. Mais la chose surprenante à propos d'un appareil photo à sténopé est
00:04:00.09 que si vous faites le trou d'épingle très petit, comme indiqué ici,
00:04:02.10 alors maintenant que seule une très petite quantité de lumière passe à travers,
00:04:07.18 puis soudain, l'image redevient floue. Et ce flou
00:04:11.04 est finalement parce que la lumière ne se déplace pas en ligne droite.
00:04:16.12 La lumière est courbée au niveau de ce trou d'épingle, elle est diffractée. Et cette flexion de
00:04:21.09 la lumière est finalement ce qui limite le microscope optique. Alors je veux
00:04:25.04 expliquez pourquoi la lumière se penche, parce que je pense que si vous comprenez pourquoi
00:04:29.00 la lumière se courbe, vous comprendrez pourquoi les microscopes ont
00:04:32.00 résolution limitée. Il se plie parce que la lumière n'est en fait pas
00:04:36.19 voyager en ligne droite, malgré le fait qu'il semble le faire.
00:04:39.24 C'est en fait que la lumière est une onde et qu'elle voyage dans tout
00:04:43.02 instructions. Ce n'est pas une idée intuitivement évidente pour la plupart des gens.
00:04:46.27 Et en fait, il fallait un grand génie, un homme nommé Christian Huygens,
00:04:51.22 pour d'abord comprendre ce fait. Christian Huygens était un Néerlandais
00:04:57.18 mathématicien. Il a fait beaucoup, beaucoup de choses. A inventé beaucoup de choses.
00:05:00.24 Il était un génie dans de nombreux domaines différents, et l'un de ses
00:05:04.12 les grands titres de gloire étaient l'optique ondulatoire. L'idée que
00:05:07.26 la lumière voyage en vagues, pas en lignes. C'était sa grande idée
00:05:11.07 et il a été contrebalancé par la brillante idée de Newton que la lumière est
00:05:16.25 fait de particules, la théorie corpusculaire de la lumière.
00:05:19.17 Et bien sûr, nous connaissons tous les photons, et ce mot
00:05:22.27 le photon a été utilisé pour la première fois par Newton. Il s'avère qu'ils étaient
00:05:27.04 à la fois raison, et à certains égards, Christian Huygens était
00:05:30.01 plus proche de la réalité, je pense, que la vision de la lumière de Newton.
00:05:33.20 Mais c'est une longue histoire. Je veux vous dire ce qu'est une théorie des ondes
00:05:38.00 dit que la lumière est en fait, au lieu d'être une ligne droite,
00:05:41.09 que la lumière peut être considérée comme voyageant comme une vague.
00:05:44.26 Et une vague pourrait être considérée comme une vague plane rectiligne,
00:05:52.19 et par une onde plane, vous auriez un front de lumière en mouvement
00:05:56.04 dans une direction droite particulière comme le disent ces flèches. Et cela
00:05:59.08 le front d'onde serait comme le breaker sur une plage. Le long de
00:06:03.13 onde linéaire se déplaçant vers l'avant, et juste derrière, à sa longueur d'onde,
00:06:09.03 est une autre vague, et derrière elle se trouve une autre vague. Alors chacun de ces
00:06:12.09 lignes verticales se compose d'une de ces vagues. Et à droite
00:06:15.17 en dessous de cette petite sinusoïde est un moyen de les représenter en 2 dimensions,
00:06:20.16 juste la direction de la vague. La vague monte et descend, mais la lumière
00:06:26.00 se déplace à gauche et à droite. C'est ce qu'on appelle une onde plane parce qu'en fait,
00:06:30.19 ce n'est pas une seule ligne qui bouge. Mais c'est en fait un avion qui agite
00:06:35.14 et juste derrière, un autre avion agite. C'est pourquoi on l'appelle un
00:06:38.23 onde plane. L'optique ondulatoire dit qu'en plus des ondes planes,
00:06:42.16 la lumière peut voyager dans des directions qui convergent vers un point
00:06:46.15 ou diverger. Et celles-ci sont connues sous le nom d'ondes sphériques, où
00:06:49.29 le front d'onde, plutôt que d'être une ligne droite, est maintenant un
00:06:53.11 surface incurvée, cela pourrait même être une sphère, que la lumière voyage
00:06:56.20 à partir d'un seul point ou convergeant vers un seul point.
00:07:00.07 Et là, vous pourriez le dessiner de cette façon. Donc des ondes sphériques
00:07:04.10 sont la courbure d'un cercle, ou d'une sphère, et des ondes planes
00:07:09.24 sont la surface d'un avion. Maintenant, l'idée de Huygens était que le
00:07:16.29 l'unité élémentaire de lumière n'était pas ces ondes planes, mais les ondes planes
00:07:22.03 et les ondes sphériques étaient composées de très petites infiniment
00:07:27.12 petits objets qui sont maintenant appelés ondelettes de Huygens, qui sont
00:07:32.00 petits points lumineux qui distribuent leur lumière dans toutes les directions
00:07:35.26 qui n'ont aucune directionnalité. Il a appelé ces vaguelettes
00:07:39.11 et à ce jour, nous utilisons ce terme. De nombreux aspects de la façon dont un
00:07:42.23 le photon se comporte dans l'espace avant d'interagir avec la matière
00:07:45.26 ressemble beaucoup à une ondelette de Huygens, c'est-à-dire que la lumière voyage
00:07:49.23 dans toutes les directions et où il finit a beaucoup à voir avec où
00:07:53.07 il n'y a pas d'interférence. Contrairement à là où il n'y en a pas
00:07:55.25 finissent par être des sites où la lumière interfère. Maintenant je vais expliquer ça
00:07:59.26 en une seconde. Ainsi, une ondelette de Huygens peut être considérée comme une
00:08:03.04 petit point lumineux pulsé. Je montre ici une sorte de schéma
00:08:06.12 de cette pulsation. Où il y aurait un point de lumière et cette pulsation
00:08:09.28 c'est en quelque sorte la fluctuation de la vague, où la distance
00:08:14.01 entre les crêtes de ces vagues sont essentiellement les
00:08:17.16 longueur d'onde de la lumière. C'est l'unité de la lumière, c'est un infiniment petit
00:08:21.28 unité. Et la lumière de longueur d'onde plus courte a l'espacement plus proche
00:08:27.08 ensemble, et la fréquence des pulsations plus élevée.
00:08:30.01 À tout instant, une ondelette peut ressembler à
00:08:37.05 ce côté sur la gauche ici, avec une série d'anneaux, chacun de
00:08:42.10 qui ont la même quantité d'énergie. Mais parce que
00:08:44.09 chaque anneau est plus grand, l'amplitude de l'onde diminue
00:08:47.16 et plus petit quand on sort à un moment donné.
00:08:51.00 L'intensité que l'on voit est le carré de l'amplitude de l'onde, et
00:08:57.26 alors il faut intégrer cela sur au moins une longueur d'onde.
00:09:01.16 Donc on a un point très lumineux, puis on s'assombrit progressivement
00:09:04.10 lumière si vous intégrez l'effet d'une ondelette au fil du temps.
00:09:08.26 Alors, comment ces ondelettes expliquent-elles les ondes planes et les ondes sphériques ?
00:09:13.18 C'est facile à voir par les dessins originaux de Huygens, et voici
00:09:18.21 une version plus moderne de ces dessins. C'est quoi un
00:09:21.21 l'onde plane, comme indiqué ici dans ce diagramme, n'est qu'une série
00:09:25.24 d'ondelettes alignées en ligne droite, comme illustré ici.
00:09:30.04 Et ces ondelettes ont un bord d'attaque, qui est le front d'onde
00:09:35.16 de chacun d'eux. Et qu'une ligne de ces bords d'attaque
00:09:40.16 donne une ligne droite. Et dans ce sens, il n'y a rien
00:09:43.19 pour interférer avec eux, pour que ça avance et le suivant
00:09:46.16 la vague vient juste derrière. Les ondes sphériques sont similaires
00:09:51.28 idée, mais plutôt que d'être une ligne droite d'ondelettes, le
00:09:55.11 les ondelettes sont à la surface d'une sphère. Et ils peuvent être soit
00:09:59.29 divergent, donc la lumière laisse un point et s'étend
00:10:02.15 dans l'espace, ou convergeant comme lorsqu'un laser est focalisé sur un point
00:10:07.06 dans un spécimen. Au-delà du spot, la lumière diverge. Donc un
00:10:11.05 onde sphérique convergente génère une onde sphérique divergente.
00:10:14.21 Il y a donc des ondes sphériques et des ondes planes. Maintenant,
00:10:18.01 comment cela nous aide-t-il à comprendre comment un trou d'épingle quand il arrive
00:10:21.28 petit ne fonctionne pas? C'est expliqué ici. Quand vous avez un très, très petit
00:10:27.04 ouverture, et vous avez une vague plane avec un tas de vaguelettes
00:10:31.18 aligné sous ce trou d'épingle, alors si le trou est très petit
00:10:35.27 seules quelques-unes, peut-être une seule ondelette, passent. Et cela
00:10:39.12 l'ondelette diffuse alors sa lumière dans toutes les directions. Et
00:10:43.01 c'est ce qu'on appelle la diffraction. Et cette diffraction explique
00:10:46.29 pourquoi si le sténopé devient très petit, la lumière ne voyage plus
00:10:49.24 en ligne droite, il se penche dans toutes ces différentes directions.
00:10:53.08 Et c'est une approximation théorique, et pourtant toutes les expériences
00:10:58.20 suggèrent que c'est en fait la façon dont la lumière se comporte.
00:11:01.17 Maintenant, une chose intéressante est que si vous avez deux ondelettes
00:11:05.18 ou plus qui proviennent de la même source, qui font partie du
00:11:08.28 même lumière pulsée d'origine, et donc ils sont cohérents.
00:11:13.15 Leurs longueurs d'onde sont synchronisées les unes avec les autres. On peut alors avoir
00:11:17.13 motifs d'interférence composés de plusieurs longueurs d'onde.
00:11:21.04 D'abord dans l'exemple avec un trou d'épingle, la lumière dans une boîte
00:11:26.07 aller dans toutes les directions. Mais la lumière qui sort se pliera,
00:11:28.26 c'est la diffraction. Et puis dans le deuxième exemple, si on a
00:11:33.18 plus d'une source, par exemple, une source lumineuse qui
00:11:36.29 passe ensuite par deux fentes, on voit à l'autre bout
00:11:40.25 plutôt qu'une lumière uniforme, un drôle de motif de bandes.
00:11:44.19 Une interférence destructrice et constructive. La lumière passe
00:11:47.26 un trou d'épingle, puis après avoir traversé deux autres trous d'épingle,
00:11:53.00 vous obtenez cette étrange interaction des endroits où se trouvent la crête
00:11:58.01 les uns sur les autres, là où les creux s'additionnent
00:12:01.23 dans un sens négatif, et les endroits où l'on est un creux
00:12:04.19 et l'un est un pic, et ensemble ils s'annulent. Alors ici dans
00:12:08.29 le temps instantané est un modèle compliqué de vagues
00:12:12.28 basé sur les interactions de deux ondelettes différentes.
00:12:16.11 Et je veux développer un peu plus cette idée, pour que vous puissiez
00:12:19.13 comprendre comment fonctionnent les microscopes optiques. Donc si nous avons une lumière
00:12:23.07 source, comme indiqué, qui envoie sa lumière dans toutes les directions,
00:12:28.13 et puis cela génère une onde sphérique composée de
00:12:31.13 un tas d'ondelettes, l'une des ondelettes pourrait traverser
00:12:34.25 un léger ici et générer un motif d'ondelette sur l'autre
00:12:39.29 côté de ce trou d'épingle. Il y a une deuxième fente dans cette boîte, et il y a un
00:12:46.20 seconde ondelette qui est passée. Et ensemble ces vaguelettes
00:12:51.02 interagissent de manière à s'additionner ou à se soustraire.
00:12:55.09 Et il y a ce modèle d'interaction. Alors regardons ce modèle
00:12:59.28 un peu plus en détail. Si nous arrivons à une position où les deux
00:13:04.21 les ouvertures d'ondelettes sont exactement équidistantes de ce point,
00:13:09.26 alors ils seront tous les deux en crête ou en creux à cette distance.
00:13:14.13 Et donc on aurait une interférence constructive. Si nous allons à une position
00:13:19.12 où l'une des distances est exactement une demi-longueur d'onde
00:13:22.29 plus long que l'autre, l'un aurait des interférences destructrices.
00:13:26.14 Il y aurait donc une lumière vive là où ils interfèrent de manière constructive et
00:13:30.26 pas de lumière là où ils interfèrent de manière destructive. Et c'est pourquoi un
00:13:35.08 aboutit à ce motif de bandes lumineuses et sombres, car l'une
00:13:38.28 peut même être à une longueur d'onde entière, on peut en être un
00:13:42.15 longueur d'onde plus longue que l'autre, et vous obtiendrez toujours
00:13:45.11 interférence constructive. Mais si c'est 1,5 longueurs d'onde
00:13:48.22 différence de longueur de chemin, alors l'un serait destructeur
00:13:52.05 par rapport à l'autre. On a donc des bandes claires et sombres qui
00:13:54.23 sur une large plage ici. Alors, comment cela nous aide-t-il
00:13:59.04 comprendre les microscopes ? Eh bien, passons en revue une seconde le chemin
00:14:02.13 un microscope est conçu. Donc un microscope prend
00:14:05.23 la lumière d'un spécimen, montré ici, et dans ce cas,
00:14:09.19 il n'y a qu'un seul point de lumière générant une sphère
00:14:12.09 vague. Et ce que fait l'objectif du microscope, c'est ce point
00:14:17.29 source, qui génère une onde sphérique qui diverge,
00: 14: 21.05 est que l'objectif recueille alors une sous-partie de ce
00:14:27.22 ondelette sphérique et transforme cette lumière en une onde plane.
00:14:33.00 Parce qu'un microscope est conçu de telle sorte que le spécimen
00:14:36.26 est exactement à la distance focale de cet objectif. Donc
00:14:40.13 ces ondes sphériques se transforment en ondes planes, et ces ondes planes
00: 14: 44.08 les ondes traversent ensuite le tube du microscope jusqu'à ce qu'il
00:14:49.10 atteint la lentille du tube, qui est une autre lentille positive, qui prend maintenant
00:14:54.00 une onde plane et la retourne, la lentille du tube fait cela, la fait tourner
00:14:58.17 l'onde plane se transforme en une onde sphérique convergente.
00:15:02.04 Et cette onde sphérique finit comme un point là-bas. Et ça
00:15:07.04 nous permet de poser la question suivante, qui est pour un point
00:15:12.04 objet dans le point focal, tel qu'un fluorescent infiniment petit
00:15:16.10 perle, quelle est la distribution de la lumière dans ou près du plan image ?
00:15:20.08 Et comment ce point se propage-t-il ? Est-ce qu'il se propage, d'abord, et si
00:15:24.18 c'est étalé, quelle est la fonction de cet écart ?
00:15:26.28 Comment se retrouve-t-il dans une distribution particulière ?
00:15:31.10 Nous allons donc passer par la même idée des ondelettes,
00:15:33.28 mais regardez maintenant dans le cas d'une sphérique convergente
00:15:39.04 vague. Nous allons regarder cette partie du microscope,
00:15:41.19 parce que c'est là que les modèles d'interférence génèrent
00:15:45.19 un mélange compliqué de mise au point sur un point et de lumière autour
00:15:50.29 ce point. Donc, c'est maintenant au-delà de la lentille du tube. La lentille tubulaire
00:15:55.09 est montré à l'extrême extrémité de cette image, il y a un
00:15:58.08 onde sphérique convergente composée d'un groupe d'ondelettes.
00:16:00.19 Et chacun de ces points infinis dans le front d'onde émergent
00:16:04.11 agit comme sa propre source de lumière ponctuelle, comme un Huygens
00:16:08.00 ondelette. C'est-à-dire que chaque point émet une ondelette, envoyant de la lumière
00:16:11.17 dans toutes les directions. Et toutes les vaguelettes de la même vague
00:16:14.20 avant sont mutuellement cohérents, ils oscillent en synchronie.
00:16:17.17 Et à cause de cela, ils peuvent interférer de manière fixe.
00:16:21.06 Par conséquent, ils interfèrent les uns avec les autres de manière très prévisible
00:16:23.19 modèle. Commençons donc maintenant avec seulement deux de ces ondelettes.
00:16:29.14 Et choisissez arbitrairement une position à mi-chemin entre eux
00:16:34.10 où se trouve cette ligne verticale, où cette distance D1 et D2
00:16:38.11 sont identiques. La distance est la même, ces deux vagues vont
00:16:42.02 à la fois creux et pic ou entre exactement
00:16:46.11 le même point. Et donc, si vous ajoutez ces deux vagues
00:16:49.13 ensemble, ils sont en phase et vous deviendrez constructif
00:16:52.19 interférence. Par distinction, si l'on descend D1 et D2 un peu plus bas sur
00: 16: 59.19 cette ligne verticale, l'une d'entre elles est maintenant une demi-longueur d'onde
00: 17: 03.18 plus long, celui du haut, D1 est une distance plus longue d'une demi-longueur d'onde
00:17:08.10 que celui du bas, D2. Et donc quand ces deux vagues atteignent
00:17:11.14 ce point, ils sont déphasés. Exactement une demi-longueur d'onde
00:17:15.17 de phase, et si vous additionnez ces deux sinusoïdes, vous allez
00:17:18.22 se retrouve avec une interférence destructrice complète et sans lumière.
00:17:21.14 Si on descend un peu plus bas, maintenant D1 est beaucoup plus long
00:17:26.19 que D2. En fait, exactement 1 longueur d'onde plus longue que D2.
00:17:30.14 Si vous additionnez ces deux vagues, vous obtiendrez un
00:17:33.25 cycle déphasé, mais ils culminent au même point
00:17:38.28 et cela génère des interférences constructives. Et voici donc
00:17:44.01 les motifs que l'on voit instantanément sur le dessus. Et en
00:17:48.09 intégré dans le temps, en bas. Et tu peux voir
00:17:52.15 que les creux et les pics d'interférence sur le
00:17:56.14 top sont maintenant tous devenus positifs et zéros.
00:18:01.04 Il n'y a pas d'amplitude négative lorsque vous placez les amplitudes au carré, maintenant
00:18:04.15 tout est d'amplitude positive ou nulle. Et cette interférence
00:18:09.15 se termine par une série de bandes. Alors un instant
00:18:12.19 dans le temps sur le dessus, il y a un maillage sombre et lumineux
00:18:15.28 lignes. Les détecteurs, y compris l'œil, ne voient cependant pas
00:18:19.21 amplitude. Nous collectons l'intensité. Et l'intensité est l'addition
00:18:24.19 d'un cycle complet de ces ondelettes et carré le résultat.
00:18:29.04 Et le motif d'interférence détecté est maintenant sombre et
00:18:32.02 lignes lumineuses. Et juste au milieu, il y a une ligne blanche
00:18:34.08 horizontalement, et c'est l'endroit où les deux
00: 18: 38.12 les ondelettes interfèrent mutuellement de manière constructive tout au long du processus
00:18:43.20 cette longueur. Les zones sombres sont les interférences destructrices, les
00:18:47.16 les zones lumineuses sont les interférences constructives. Nous avons donc traité
00:18:49.15 avec deux ondelettes. Et maintenant je veux juste dire un peu sur
00:18:53.15 la façon dont fonctionnent les microscopes, dans le sens où il n'y a rien
00:18:57.19 jusqu'à présent dans ce que j'ai dit qui vous dirait où le
00:19:00.17 plan d'image pour ces ondes sphériques convergentes sont.
00:19:03.26 Il y a juste un motif de bandes claires et sombres. Vous allez
00:19:07.06 voir que cette approche, sans aucune compréhension supplémentaire
00:19:11.10 de l'optique des rayons, génère le plan de l'image à un plan particulier
00:19:15.06 en grande partie parce que c'est le seul endroit où toutes les vaguelettes
00:19:20.11 peut être en phase en même temps. Mais avant d'en parler, nous
00:19:24.18 doivent faire face au fait que les objectifs de microscope
00:19:26.23 se décline en plusieurs saveurs. Et la saveur particulière dont je veux parler
00: 19: 30.06 maintenant n'est pas la différence de grossissement,
00: 19: 32.20 que de nombreux microscopistes débutants pensent être le plus important
00:19:38.05 aspect d'un objet, mais ce n'est pas le cas. Ce qui compte vraiment pour le
00:19:42.05 qualité d'un objectif et son pouvoir de résolution est sa valeur numérique
00:19:45.16 ouverture, NA. Et le NA a une description bizarre, c'est le
00:19:50.19 indice de réfraction du matériau entre le microscope
00:19:53.25 objectif et le toboggan, qui dans l'air serait très proche de
00:19:57.24 1, ou 1.0. Mais dans l'eau, la glycérine ou l'huile, ce nombre pourrait être
00:20:03.22 plus haut. Fois le sinus du demi-angle entre une verticale
00:20:08.16 et la plus grande déviation de lumière qui pourrait encore être
00:20:13.25 collecté par l'objectif. Donc un objectif à faible ouverture numérique
00:20:17.25 comme indiqué en A, a un cône étroit qui peut collecter la lumière
00:20:22.04 se détache du spécimen. Donc si vous avez un fluo
00:20:25.02 spécimen qui envoie de la lumière dans toutes les directions, vous ne collectez que
00:20:27.29 une petite quantité avec un objectif à faible ouverture numérique.
00:20:30.22 Un objectif à ouverture numérique moyenne a un
00:20:34.14 cône qu'il recueille. Et un objectif à haute ouverture numérique
00:20:37.15 a le cône le plus haut de tous. C'est un fait, et je vais essayer d'expliquer
00:20:42.08 pourquoi, que plus l'ouverture numérique est élevée, mieux c'est
00:20:45.04 le pouvoir de résolution du microscope. Et il faut y revenir
00:20:48.25 image d'ondelettes et regardez la différence en haut entre
00:20:52.09 un objectif à haute ouverture numérique et en bas, un faible
00:20:56.06 objectif à ouverture numérique. Donc dans les deux cas, on a une ondelette
00:20:59.12 générant de la lumière et vous voyez que vous en collectez une plus grande partie
00:21:03.07 de cette onde sphérique avec la lentille à haute NA. donc un plus grand
00:21:10.03 quantité de lumière est collectée, et cela génère un
00:21:12.11 plus grosse, en gros une vague plane plus grosse, qui a finalement
00:21:17.14 va à la lentille du tube. Et puis de la lentille du tube,
00:21:21.02 c'est converti en une onde sphérique convergente.
00:21:24.28 Donc, avec un objectif à grande ouverture numérique, vous avez plus
00:21:27.09 de l'onde sphérique collectée. Et ainsi vous générez un plus grand
00:21:31.22 onde sphérique sortant vers le plan image. Avec un
00:21:36.16 objectif à ouverture numérique inférieure, vous avez une plus petite quantité
00:21:40.02 de l'onde sphérique collectée. Et les bords de ça
00:21:46.00 onde sphérique sont très proches les unes des autres, par rapport à une valeur numérique élevée
00:21:50.14 objectif d'ouverture où les parties les plus extrêmes de la sphérique
00:21:55.25 les ondelettes convergentes sont très éloignées les unes des autres. Et cela s'avère
00:22:00.06 pour être la caractéristique critique pour la résolution, comme vous le verrez.
00:22:02.26 Donc, si nous comparons les ondelettes extrêmes d'une courbe
00:22:08.07 onde sphérique dans un objectif à haute ouverture numérique et une faible
00:22:12.01 objectif à ouverture numérique, vous pouvez voir que l'effet de cela
00:22:15.21 est un modèle différent de réduction à cet arbitraire
00:22:20.17 position ici, qui sera le plan image mais il n'y a encore rien à vous dire
00:22:24.10 pourquoi. Parce que deux ondelettes ne se concentrent pas sur une image. Alors le
00:22:28.15 les franges les plus fines déterminent les détails les plus fins qui peuvent être trouvés dans un
00:22:32.08 objectif. C'est ce qui limite la résolution d'une image, comment
00:22:36.13 c'est bien ce motif de bandes. Et cette période qui est la distance
00:22:40.24 entre les zones claires et sombres est liée au numérique
00:22:45.26 ouverture. Si les deux ondelettes sont éloignées, alors l'interférence
00:22:50.00 permet un jeu de bandes sombres et claires à très haute fréquence. Si les deux
00:22:56.19 les ondelettes sont très proches les unes des autres, comme dans une faible ouverture numérique
00:22:58.28, alors la bande est plus étendue. Et cela limite la
00:23:03.09 les plus fins détails dans le plan de l'image. Alors maintenant essayons de ne pas juste regarder deux
00:23:07.17 ondelettes, mais ajoutez de plus en plus d'ondelettes à cette convergence
00:23:10.18 onde sphérique. Et regarde ce qui arrive au pattern intégré
00:23:14.22 d'interférence vers un plan qui devient finalement le plan image.
00:23:20.00 Donc d'abord, une ouverture numérique élevée donne une frange courte et
00:23:24.02 donne des franges étroites. La faible ouverture numérique donne une longue frange
00:23:26.26 période et larges franges. Alors maintenant, quelle que soit l'ouverture numérique
00:23:31.26 nous avons, nous allons avoir une onde sphérique convergente
00:23:34.02 c'est cette circonférence bleue que l'on voit en haut
00:23:37.27, la lentille du tube est en haut. Et maintenant ce que je te montre c'est le
00:23:42.23 deux ondelettes au bord de l'objectif, plus une ondelette juste à
00:23:49.20 le centre. Donc trois ondelettes interfèrent. Et nous regardons le
00:23:53.20 modèle qui est généré par ces trois ondelettes après que nous
00:23:57.19 intégrer sur une longueur d'onde et carré le résultat.
00:24:02.17 L'intensité enregistrée est la série de motifs de barres qui tournent
00:24:06.15 dans les îles, au lieu des rayures, nous avons maintenant des îles
00:24:10.21 de clair et sombre. Et au plan image, qui finira
00:24:14.26 où cette ligne est ici, on voit qu'il y a une île
00:24:20.05 de brillant en plein centre, et c'est parce qu'à cela
00:24:23.07 point là, vous êtes à égale distance de ces trois ondelettes
00:24:26.08 parce que ce point est le centre d'un cercle pour lequel ces
00:24:30.26 trois ondelettes sont sur la circonférence de ce cercle. Donc
00:24:34.11 ils sont à égale distance de ce point et c'est pourquoi c'est
00:24:38.01 où l'image est focalisée à ce point pour le spécimen
00:24:42.00 qui est situé au centre du champ d'image.
00:24:45.00 Et la diapositive la plus brillante est là parce que l'interférence
00:24:49.17 le motif est le plus fort parce que vous avez les trois ondelettes
00:24:52.08 en phase là-bas, mieux que partout ailleurs.
00:24:55.01 Si nous regardons cinq ondelettes, ajoutez simplement deux autres en plus des trois
00:25:00.19 dont j'ai déjà parlé, encore une fois la frange la plus brillante
00:25:03.27 est au centre du plan image, car c'est celui-là
00:25:07.16 place que les cinq sont mutuellement cohérents. Partout ailleurs
00:25:12.01 certaines interférences de manière négative détruisent le
00:25:16.07 intensité. Et toutes les longueurs d'onde sont en phase au centre du
00:25:19.23 plan image. Et c'est donc la zone la plus lumineuse. Et tu peux
00:25:22.20 voir à mesure que vous ajoutez de plus en plus de contraste et d'amélioration,
00:25:26.10 en plus de ces trois îles lumineuses, il y a beaucoup de petits
00:25:30.23 lobes latéraux plus faibles. Cela fait donc cinq ondelettes.
00:25:34.19 Si on passe à neuf ondelettes, l'image devient plus droite
00:25:39.27 d'une certaine manière, c'est encore le seul endroit où tous ces
00:25:43.02 les ondelettes sont en phase car elles sont équidistantes les unes des autres
00:25:45.24 autre, est juste à ce point là. Et toutes les vaguelettes
00:25:51.15 sont en phase là-bas, et c'est le pic principal. Mais il y a
00:25:55.11 cet ensemble de bandes de chaque côté de ce point. Maintenant si nous
00:26:00.16 il suffit d'ajouter toutes les ondelettes ensemble, c'est la fonction d'étalement du point, c'est
00:26:04.16 passant de neuf ondelettes à un nombre infini. Allons-y
00:26:07.26 à travers la forme de cet objet maintenant. Toutes les ondelettes sont
00:26:12.02 en phase au centre du plan image, la lumière est concentrée
00:26:16.03 au milieu du plan image. Toutes les franges ou
00:26:19.17 les lobes latéraux s'atténuent progressivement. En fait, vous avez besoin d'une intensité accrue
00:26:24.09 pour les voir, comme le montre cette image horizontale tout en bas.
00:26:28.11 Et la plupart de la lumière est maintenant vue dans un cône, il semble que tout
00:26:33.03 l'interférence a laissé très peu de lumière en dehors de cette convergence
00:26:39.07 cône de lumière qui se focalise sur le spécimen puis rediverge.
00:26:42.29 C'est une forme de sablier. Et cela ne vient pas par
00:26:46.14 rayons optiques, mais juste par interférence d'ondelettes.
00:26:49.11 La largeur du pic principal est définie par les ondelettes extrêmes,
00:26:55.04 les deux aux deux extrémités de cette calotte sphérique. Et c'est
00:27:00.24 réglé par l'ouverture numérique. Donc la taille de l'image
00:27:04.23 pour un très petit point est lié à la distance qui les sépare
00:27:09.16 les ondelettes sont. Plus ils sont éloignés, plus ils sont concentrés
00:27:12.15 cet objet est. Et c'est pourquoi l'ouverture numérique est
00:27:16.07 essentiel. Donc, si nous comparons l'effet de l'ouverture numérique
00:27:19.24 sur la fonction d'étalement du point, une ouverture numérique élevée par rapport à faible
00:27:23.02 ouverture numérique, vous voyez une différence profonde. Avec une haute
00:27:26.07 ouverture numérique, il y a une séparation plus large entre les ondelettes,
00:27:28.26 ce qui est possible car ils sont éloignés l'un de l'autre. Par conséquent,
00:27:33.09 il y a un petit pic central, alors qu'avec de faibles chiffres
00:27:36.05 lentilles d'ouverture, seule une séparation étroite entre le
00:27:39.19 les ondelettes sont possibles, vous avez donc un large pic central
00:27:42.14 et moins de résolution. Alors, réfléchissons maintenant à cela en termes
00:27:48.20 à quoi ressemble l'image d'un point. Donc si nous nous concentrons maintenant
00:27:54.11 pas dans la direction axiale, mais en regardant la surface d'une image qui
00:28:01.27 point, juste dans le plan focal, le point dans le spécimen apparaîtrait
00:28:06.13 comme un petit point. Ce point est appelé un disque aéré parce que
00:28:12.19 si vous améliorez le contraste, vous constatez que le point est entouré de
00: 28: 17.01 ces anneaux de lumière plus faibles, qui sont le motif de diffraction
00:28:21.26 du point. C'est la fonction d'étalement du point dans un
00:28:25.12 un seul avion. Airy est le nom d'un chercheur, je pense qu'il était
00:28:32.02 un astronome, qui a vu des motifs aériens autour des étoiles
00:28:35.15 et j'ai compris qu'il s'agissait d'un artefact de diffraction.
00:28:38.12 Pas le fait que chaque étoile ait des anneaux autour d'elle. Le PSF est
00:28:43.26 une série d'anneaux concentriques, et des anneaux plus grands ont progressivement
00:28:48.11 plus bas -- plus les anneaux sont éloignés, plus ils descendent
00:28:52.15 l'intensité. Et si tu dois te souvenir de quoi que ce soit dans
00:28:56.06 microscopie optique, en termes d'équations, ce serait
00:28:58.12 ceci. Que la distance du centre du disque aéré,
00:29:02.15 ce cercle central, jusqu'au premier anneau noir, est 0,61 fois le
00:29:10.01 longueur d'onde de la lumière, lambda, divisée par le numérique
00:29:13.16 ouverture de l'objectif. 0,61 lambda sur NA. Vous voulez porter
00:29:17.08 autour de tout fait sur les microscopes optiques, c'est celui-là
00:29:20.16 tu devrais emporter partout. Parce que comme vous le verrez, c'est le
00:29:22,28 limite de résolution du microscope optique, 0,61 lambda sur NA
00:29:26.23 est la distance entre le centre et le premier anneau sombre. On peut aussi
00:29:30.17 regardez le motif aérien dans la direction non latérale, mais dans le
00:29:34.05 direction axiale, en XZ. X étant le latéral, et Z étant le
00:29:39.23 plan de profondeur. Et on voit que le modèle de zone n'est pas
00:29:43.19 un cercle, mais plutôt une ellipse. Et encore, il y a deux
00:29:47.21 -- si vous l'améliorez, il y a deux taches sombres dans cette direction
00:29:51.16 et c'est une distance plus longue. C'est déterminé par une autre équation
00:29:55.12 2 fois l'indice de réfraction du matériau entre le
00:29:58.23 objectif et le spécimen, donc 2 fois n fois la longueur d'onde,
00:30:02.22 divisé par NA au carré. Et pour une grande ouverture numérique
00:30:06.08 lentilles, c'est parfois environ trois fois plus gros
00:30:09.17 que la résolution XY. Donc les microscopes optiques intrinsèquement
00:30:12.26 ont une résolution légèrement meilleure dans le plan latéral que leur
00:30:16.24 capacité à discriminer un plan d'un autre dans la profondeur
00:30:20.03 avion. Alors, pouvons-nous l'utiliser pour nous aider à comprendre la résolution
00:30:26.28 dans un microscope optique ? Ce 0,61 lambda sur NA.
00:30:30.18 La distance entre le centre et ce premier pic sombre.
00:30:33.03 Il y a, si vous y réfléchissez, ce sont les chiffres
00:30:37.07 calculé pour un objectif à haute ouverture numérique, le 1.4
00:30:42.01 objectif à ouverture numérique avec lumière à 480 nm. Tu peux voir
00:30:48.00 que la résolution latérale, et je vais expliquer pourquoi sa résolution
00:30:51.04 est de 225 nm, alors que la résolution de l'axe Z est de 861 nm.
00:30:58.06 Pas aussi bien. Alors, à quel point est-il possible pour deux
00:31:05.27 les sources ponctuelles doivent être et toujours être vues comme deux points ?
00:31:09.25 C'est fondamentalement la question à résoudre. Si deux objets sont
00:31:13.16 fermer, et vous pensez toujours qu'il s'agit d'objets séparés, alors
00:31:17.02 vous pouvez les résoudre. S'ils se mélangent, vous ne pouvez pas les résoudre.
00:31:20.28 Voici, par exemple, deux sources ponctuelles. Et ils bougent
00:31:24.09 progressivement plus proche. Là, ils sont assis au-dessus de chacun
00:31:27.22 autre en bas, et ils sont loin l'un de l'autre en haut.
00:31:30.02 Personne ne contestera qu'ils sont deux points au sommet. Personne
00:31:33.10 croirait qu'il s'agit de deux points en bas. Comment pouvons-nous
00:31:36.16 décider quand ces deux points peuvent être résolus ? C'est parfois
00:31:40.28 connu sous le nom de critère de Rayleigh. C'est un critère arbitraire.
00:31:43.24 Ce n'est pas un critère généralement accepté que tout le monde dit
00:31:48.02 vous indique la résolution, mais la plupart des microscopistes utilisent le Rayleigh
00:31:51.07 critère. Quel est le critère lié à 0,61 lambda
00:31:55.00 sur NA. Cette distance. Alors cette distance, comme je vous l'ai déjà dit,
00:32:01.02 est la distance entre le centre d'un disque et son premier
00:32:04.25 anneau sombre. Et si on regarde ces traces ici, ce sont les
00:32:08.06 deux points qui sont juste au critère de Rayleigh à part, c'est
00:32:12.13 0,61 lambda sur NA, le centre de cet objet est assis
00:32:16.16 juste sur le premier anneau sombre de cet objet. Si tu regardes ici
00:32:20.28 à une trace d'intensité, où la première est au plus bas
La valeur 00:32:24.19 est celle où l'autre atteint son maximum. Et à ça
00:32:29.01 position, il y a peut-être un peu plus de 20% d'un plongeon
00:32:35.00 d'intensité entre eux lorsque vous ajoutez les deux intensités.
00:32:37.22 On peut aussi faire le critère de Rayleigh dans l'axe z.
00:32:41.11 Où vous allez du centre de l'un au premier anneau sombre,
00:32:45.22 à son premier anneau sombre et à son autre objet à cette distance. Et ça encore
00:32:50.12 vous donne une valeur où ils plongent d'environ 19%. Et ce sont les deux
00: 32: 55.03 lié à l'autre équation que j'ai mentionnée,
00:33:00.28 2 n lambda sur NA au carré. Alors qu'il s'agit de 0,61 lambda sur NA.
00:33:05.02 Maintenant, la valeur de l'ouverture numérique est qu'elle rend ces points plus petits.
00:33:09.00 Donc vraisemblablement, la fonction d'étalement des points en étant plus petite
00:33:12.09 permet de rapprocher les objets. Et voici un
00:33:15.07 exemple classique de ceci. C'est un tas de perles où
00:33:18.29 ils ont été photographiés avec un objectif à faible ouverture numérique, un
00:33:22.09 à ouverture numérique moyenne et un objectif à grande ouverture numérique.
00:33:24.19 Il n'y a pas de différence de grossissement, mais il n'y en a pas
00:33:27.06 doute en C, que vous ayez un tas de perles individuelles avec beaucoup
00:33:31.00 d'anneaux autour d'eux, mais vous les voyez toujours comme séparés.
00:33:34.05 Dans le milieu NA, c'est un peu plus difficile à faire. Et dans le bas NA
00:33:37.07 c'est juste une grosse goutte, vous ne pouvez pas vraiment savoir ce que vous cherchez
00:33:40.24 à, pas du tout. Je veux juste dire une dernière chose, qui est importante
00:33:46.28 à réaliser, c'est si vous voulez obtenir la résolution de votre lumière
00:33:53.04 microscope, vous devez non seulement comprendre ce qui le limite
00:33:56.25 en termes de limite de diffraction, mais vous devez échantillonner l'image
00:34:01.04 à une fréquence suffisante pour que vous puissiez voir ces hautes fréquences
00:34:06.03 détails. Et cela vous oblige à garder à l'esprit la limite de Nyquist.
00:34:10.11 Et Nyquist, il a été nommé d'après un scientifique, Harry Nyquist,
00:34:14.06 qui a déclaré que le son doit être échantillonné au moins à son maximum
00:34:19.15 fréquence dans le son multipliée par deux, il doit donc être échantillonné deux fois
00:34:28.05 à sa fréquence la plus élevée pour extraire toutes les informations
00:34:31.02 de la bande passante et représentent avec précision l'original
00:34:34.13 énergie acoustique. Ainsi, par exemple, l'oreille humaine entend des fréquences
00:34:37,14 jusqu'à 20 kHz, donc un CD, si vous en avez un, échantillonnera à 44,1 kHz.
00:34:43.19 Pour que vous puissiez entendre clairement ces 20 kHz. Les lignes téléphoniques transmettent des fréquences
00:34:48.27 jusqu'à 4 kHz, donc les compagnies de téléphone échantillonnent à 8 kHz. Alors le
00: 34: 53.09 le théorème d'échantillonnage dit, et ce n'est que le théorème de Nyquist,
00:34:55.22 une fonction continue, par exemple, un motif de bandes
00:35:00.22 dans une image, peut être complètement représenté par un ensemble
00:35:03.04 d'échantillons également espacés si les échantillons se produisent à plus
00:35:07.14 que deux fois la fréquence de la composante de fréquence la plus élevée
00:35:10.13 de la fonction. Donc pour capturer une fonction avec un maximum
00:35:13.24 fréquence F, quelle qu'elle soit, quelle que soit l'image que vous regardez,
00:35:16.19 vous devez le résoudre, vous devez prélever des échantillons qui sont
00:35:21,02 deux fois cette résolution la plus élevée, deux fois cette fréquence.
00:35:24.16 Et c'est la limite de Nyquist. Et ici, ça montre juste pourquoi
00:35:28.25 vous devez le faire. Si vous avez un motif de bandes et que le rouge est
00:35:31.20 une sorte de zone qui va du clair au sombre, du clair au sombre,
00:35:34.26 et vous n'échantillonnez qu'aux limites de résolution, donc vous en obtenez un
00: 35: 38,22 échantillon par vague de ce cycle sombre clair, vous allez finir
00:35:43.12 avec alias. Vous allez vous retrouver avec un modèle de
00:35:46.21 clair et sombre ce ne sera pas la fréquence. Tu veux voir ça
00:35:50.29 haute fréquence, vous devez avoir au moins un échantillon de chaque
00:35:53.19 pic et chaque creux. Et j'ai juste souligné cela parce que la plupart
00:35:57.28 microscopistes, ils se débrouillent très bien et deviennent très fantaisistes
00:36:00.08 objectifs, puis ils tombent du côté de l'imagerie. Ils ne
00:36:04.10 fait de l'imagerie limitée par Nyquist. Ainsi, par exemple, si la limite de résolution
00:36:08.11 est 0,61 lambda sur NA, et vous voulez voir cette résolution,
00:36:12.24 vous allez devoir échantillonner suffisamment pour qu'il y ait au moins
00:36:16.21 deux pixels entre ces deux. La limite de Nyquist est donc
00:36:23.16 0,3 lambda sur NA. Et il faut soit zoomer le
00:36:27.17 image au microscope, utilisez un objectif à grossissement plus élevé pour
00: 36: 31.07 assurez-vous que l'un correspond à l'appareil à couplage de charge,
00:36:34.11 ou tout autre appareil de numérisation que l'on utilise pour l'image,
00:36:38.11 pour s'assurer que la taille des pixels sur l'image est double
00:36:42.04 la limite due à la fonction d'étalement des points. C'est super tout ça,
00:36:49.21 parfois, cependant, ce n'est pas suffisant. Et je veux juste finir
00:36:54.04 ceci en vous disant qu'il y a encore des choses que les gens
00:36:57.07 peut faire si vous sentez que vous avez besoin de plus de résolution que votre microscope
00:37:01.03 les objectifs peuvent vous donner. L'un est que parce que c'est 0,61 lambda sur NA,
00:37:07.04 si vous utilisez une lumière de longueur d'onde plus courte, vous aurez mieux
00:37:10.03 résolution que les lumières de longueur d'onde plus longue. Alors la lumière bleue ou
00:37:12.14 la lumière ultraviolette vous donnera une image plus nette que
00:37:15.26 lumière rouge ou lumière infrarouge. Si cela ne suffit pas, vous pouvez garder
00: 37: 21.08 allant à un indice plus élevé des liquides d'immersion, car 0,61 lambda sur NA,
00:37:26.15 le terme NA est lié à l'indice des temps de réfraction
00:37:31.17 le demi-angle. Plus l'indice de réfraction est élevé, plus
00:37:34.21 la résolution. Donc l'huile est meilleure que la glycérine, et la glycérine est
00:37:38.24 mieux que l'eau, et l'eau est meilleure que l'air.
00:37:41.22 Et il existe même des huiles très ésotériques qui vous permettent
00:37:45.05 pour pousser dans des ouvertures numériques très, très élevées. Ils puent
00:37:50.11 huiles, pas très faciles à obtenir, mais il y a des choses que vous pouvez faire.
00:37:53.23 Un microscope confocal auquel de nombreuses personnes ont accès,
00:37:58.27 s'il est utilisé correctement peut améliorer votre résolution par la racine carrée de 2,
00:38:02.13 par environ 1.4. C'est donc quelque chose à penser.
00:38:05.10 Et si vous pouvez étudier des points isolés, vous pouvez localiser
00:38:11.23 en regardant le centre du disque aéré, et cela peut vous donner
00:38:15.22 super résolution. Et cette résolution arbitrairement élevée
00:38:19.00 a été utilisé pour suivre les objets se déplaçant dans le temps, et il est
00:38:22.18 également la base de l'une des nombreuses nouvelles techniques connues sous le nom de
00:38:27.13 techniques de super résolution, nanoscopie optique, dont je ne parlerai pas
00:38:30.12 environ aujourd'hui. Mais quelqu'un vous fournira probablement des informations.
00:38:34.01 Alors merci beaucoup.


Jugement du bétail

Notions de base

Après avoir appris pourquoi le bétail est jugé, vous pouvez commencer à comprendre pourquoi il faut beaucoup de pratique pour devenir un bon juge du bétail. Dans cette section, la carte de placement, une classe de bétail et le concours de jugement de bétail seront discutés.

Placer la carte

La carte de placement est l'enregistrement officiel de la façon dont une personne a placé une classe. Chaque fois que vous jugez une classe de bétail, vous recevrez une carte de placement. Le type de cartes de placement utilisées dans les concours du Mississippi est illustré à la figure 1 (ci-dessous). D'autres concours peuvent utiliser des cartes de placement similaires. Dans le bloc de concours A, indiquez dans quelle division vous concourez (probablement Junior ou Senior). Le bloc B est pour votre numéro d'équipe et votre numéro de concurrent (exemple 1-A). Le bloc C est pour le nom de classe et le numéro de classe. Mettez le nom de la classe dans ce bloc (par exemple, Angus Heifers). Les blocs pour D et E sont à usage officiel uniquement et doivent rester vides. Enfin, dessinez un cercle autour de votre placement souhaité dans la partie inférieure de la carte.

Dans l'exemple, un concurrent junior (1-A) a placé la classe 4, Angus Heifers, 3-1-4-2. Ce placement indique que l'animal le plus désirable est le numéro 3 et l'animal le moins désirable est le numéro 2.

Assurez-vous que chaque carte que vous remettez a votre numéro de participant et que vous avez indiqué le nom de la classe. Encerclez un seul placement sur votre carte de jugement et vérifiez votre placement avant de rendre votre carte.

Classe de bétail

Une classe dans un concours de jugement de bétail se compose de quatre animaux d'une race, d'un sexe et d'un groupe d'âge particuliers, tels que Suffolk Yearling Ewes, Dorset Ram Lambs, Crossbred Market Hogs, Duroc Boars, Summer Yearling Hereford Bulls et Brangus Heifer Calves. Les animaux seront numérotés 1, 2, 3 et 4 afin qu'ils puissent être facilement identifiés. Les numéros seront probablement sur le dos ou les bras des personnes tenant les animaux. Une exception possible à ce système est lors du jugement des bovins de boucherie ou des moutons et que les animaux sont attachés ou maintenus dans des râteliers. Lorsque c'est le cas, numérotez les animaux de gauche à droite en vous tenant derrière eux.

Concours de jugement de bétail

Un concours de jugement de bétail comprend des classes de bovins de boucherie, de moutons et de porcs. Vous pouvez juger soit les classes de marché, soit les classes d'élevage, soit les deux. Si vous placez la classe correctement, vous recevrez un score de 50 points pour le placement. Si vous placez incorrectement une ou deux paires, ou si vous faites d'autres erreurs de placement, votre score sera déterminé par la gravité de l'erreur.

Dans de nombreux événements de jugement, vous aurez l'occasion de donner des raisons orales. Les motifs oraux vous permettent de justifier votre classement devant un juge officiel. Le juge officiel vous notera sur l'exactitude, l'exhaustivité, la longueur, la présentation et la livraison, et la terminologie. Un score de 50 points est le plus élevé attribué pour des raisons orales. Des informations détaillées sur les raisons peuvent être trouvées dans la section « Raisons » suivante de ce manuel.

Un concours de jugement de bétail est simplement une collection de diverses classes de bétail. Il peut y avoir autant de classes dans un concours que les officiels le désirent habituellement, il y a au moins deux classes.

Suivez toujours les instructions de votre chef de groupe ou du responsable du concours. Si vous avez des questions, posez-les à votre chef de groupe et non à un autre participant. Aucune conversation entre les concurrents n'est autorisée pendant le concours.

À l'approche d'une classe de bétail, on vous demandera probablement de tourner le dos à la classe et d'étiqueter votre carte de placement. Ne commencez pas à juger avant d'y être invité !

Une fois que « le temps est venu », commencez à juger. Vous aurez de 10 à 15 minutes pour placer un cours, la plupart des cours durent 15 minutes. Avec environ 2 ou 3 minutes restantes dans une classe, il vous sera demandé de marquer votre carte. Assurez-vous que votre numéro de participant, le nom et le numéro de la classe et le classement figurent sur la carte. Lorsque « le temps est écoulé », tournez le dos à la classe, vérifiez une dernière fois votre classement et remettez votre carte de placement à votre chef de groupe.

Figure 1. Placement de la carte.

Comment commencer

Avant de commencer à juger le bétail, essayez de vous faire une image mentale de l'animal parfait. Pour ce faire, rappelez-vous des caractéristiques les plus souhaitables des animaux de haute qualité que vous avez vus et en pensant qu'ils appartiennent à un seul animal. Vous pouvez également étudier des images de champions, des rapports d'exposition, des magazines d'élevage actuels ou des images de type idéal des associations de race.

Dans le système de concours, quatre animaux sont généralement dans chaque classe. Lorsque vous jugez, divisez la classe en trois paires : une paire supérieure, une paire intermédiaire et une paire inférieure. Faites des comparaisons entre ces paires. Lorsque vous regardez n'importe quelle classe, ayez cinq animaux à l'esprit : les quatre de la classe et l'animal idéal de cette race, sexe et groupe d'âge.

Développer un système de jugement

A chaque fois que vous jugez une classe de bétail ou analysez un groupe de bétail, comptez sur un système d'observation des animaux.

Voici quelques conseils pour juger une classe de bétail :

  • Reculez - Laissez suffisamment d'espace entre vous et les animaux afin que vous puissiez voir les quatre animaux à la fois. Habituellement, 25 à 30 pieds est une bonne distance pour voir la classe. Devenez habile à placer les classes à distance et ne manipulez les animaux que pour confirmer vos observations. C'est une erreur de placer une classe uniquement avec vos mains. Une exception concerne les agneaux de marché, qui sont souvent soumis à une évaluation visuelle ainsi qu'à une manipulation.
  • Trois angles – Essayez de regarder la classe de côté, de face et de dos. Comparez chaque animal aux autres de la classe et à l'animal « idéal » que vous avez imaginé.
  • Les grandes choses d'abord - Recherchez et analysez toujours les bonnes et les mauvaises caractéristiques de chaque animal dans les principaux domaines tels que la taille du corps, le volume, la condition, la musculature, l'équilibre, l'exactitude structurelle, le mouvement et le caractère de la race. Apprenez à étudier attentivement les animaux. Concentrez-vous sur les parties de l'animal qui produisent les coupes à prix élevé. Un juge avisé du bétail est ordonné et n'est jamais aléatoire. Faites vos classements en fonction des grandes choses, à moins qu'une paire d'animaux soit très similaire, vous obligeant à analyser les différences mineures entre les animaux.
  • Placer la classe – Une fois que vous avez analysé les facteurs importants qui entrent en jeu dans le placement d'une classe, placez la classe. Marquez votre placement en haut de votre cahier ou de votre carte de motivation et commencez à prendre des notes. Une discussion plus approfondie sur la prise de notes et le format des motifs se trouve dans la section « raisons orales » de ce manuel.
  • Inspection approfondie – Habituellement, vous aurez un certain temps pour une inspection minutieuse d'une classe. Lorsque vous êtes à proximité des animaux pour une inspection minutieuse ou une manipulation, confirmez simplement les décisions que vous avez prises à distance. Si un animal semble différent (ou se comporte différemment) de ce à quoi il ressemblait de loin et si la différence mérite d'être prise en compte, modifiez votre placement. Une inspection minutieuse est différente pour chaque espèce, elles seront donc traitées séparément.

Bovins de boucherie – Lors d'une inspection minutieuse des bovins de boucherie, vous ne serez probablement pas autorisé à manipuler des animaux reproducteurs, mais vous pourriez être autorisé à manipuler des animaux dans une classe de marché. Si vous êtes autorisé à manipuler les animaux, déplacez-vous doucement et prudemment afin de ne pas exciter ou effrayer les animaux (voir « Manipulation des bouvillons du marché »).

Moutons - Lors d'une inspection minutieuse des moutons, vous pouvez ou non être autorisé à gérer les classes d'élevage et de marché. Encore une fois, déplacez-vous doucement et prudemment afin que les animaux ne deviennent pas nerveux ou excités. Une section de ce manuel traite de la méthode préférée de manipulation des moutons (voir « Manipulation des agneaux de marché »).

Porcs – Il n'y a pas de directives prédéterminées pour une inspection minutieuse des porcs, car les porcs sont généralement jugés en liberté dans un enclos. À tout moment pendant le cours, vous pouvez vous agenouiller et regarder les soulignements, les encoches des oreilles ou les pieds et les jambes. Intégrez cela à votre routine habituelle de jugement des porcs.

Prenez du recul et prenez des notes - Même s'il ne s'agit pas d'un cours de raisons ou de questions, écrivez quelques notes sur les raisons pour lesquelles vous avez placé le cours de cette façon. S'il s'agit d'un cours sur les raisons ou d'un cours avec des questions, éloignez-vous de la classe et écrivez vos notes pour les raisons. Si vous n'êtes pas sûr de quelque chose, essayez de le regarder à nouveau ou de l'omettre. Si vous n'êtes pas sûr et devinez, vous aurez probablement tort. Essayez d'être précis et descriptif lorsque vous écrivez des notes et rappelez-vous à quoi ressemblent les animaux.


Contenu

Au début des années 1970, le théoricien russe Alexei Olovnikov a reconnu pour la première fois que les chromosomes ne pouvaient pas répliquer complètement leurs extrémités. Sur cette base, et pour tenir compte de l'idée de Leonard Hayflick d'une division cellulaire somatique limitée, Olovnikov a suggéré que les séquences d'ADN sont perdues chaque fois qu'une cellule se réplique jusqu'à ce que la perte atteigne un niveau critique, moment auquel la division cellulaire se termine. [1]

En 1975-1977, Elizabeth Blackburn, en tant que stagiaire postdoctorale à l'Université de Yale avec Joseph G. Gall, a découvert la nature inhabituelle des télomères, avec leurs simples séquences d'ADN répétées composant les extrémités des chromosomes. [2] Blackburn, Carol Greider et Jack Szostak ont ​​reçu le prix Nobel 2009 de physiologie ou médecine pour la découverte de la façon dont les chromosomes sont protégés par les télomères et l'enzyme télomérase. [3]

En 1983, Barbara McClintock, cytogénéticienne américaine et première femme à recevoir un prix Nobel non partagé de physiologie ou de médecine, a reçu le prix Nobel pour avoir observé que les chromosomes dépourvus de parties terminales devenaient « collants » et a émis l'hypothèse de l'existence d'une structure spéciale au niveau de la pointe chromosomique qui maintiendrait la stabilité chromosomique. [4]

Fin du problème de réplication Modifier

Au cours de la réplication de l'ADN, l'ADN polymérase ne peut pas répliquer les séquences présentes aux extrémités 3'. Ceci est une conséquence de son mode de synthèse d'ADN unidirectionnel : il ne peut attacher de nouveaux nucléotides qu'à une extrémité 3' existante (c'est-à-dire que la synthèse progresse de 5' à 3') et nécessite donc une amorce pour initier la réplication. Sur le brin principal (orienté 5'-3' dans la fourche de réplication), l'ADN-polymérase se réplique en continu du point d'initiation jusqu'à l'extrémité du brin, l'amorce (faite d'ARN) étant ensuite excisée et remplacée par l'ADN.Le brin retardé, cependant, est orienté 3'-5' par rapport à la fourche de réplication de sorte que la réplication continue par l'ADN-polymérase est impossible, ce qui nécessite une réplication discontinue impliquant la synthèse répétée d'amorces plus loin 5' du site d'initiation (voir retard réplication de brin). La dernière amorce impliquée dans la réplication du brin retardé se trouve près de l'extrémité 3' de la matrice (correspondant à l'extrémité 5' potentielle du brin retardé). À l'origine, on croyait que la dernière amorce se trouverait à la toute fin de la matrice, ainsi, une fois retirée, l'ADN-polymérase qui remplace les amorces par l'ADN (ADN-Pol chez les eucaryotes) [note 1] serait incapable de synthétiser le "ADN de remplacement" de l'extrémité 5' du brin retardé de sorte que les nucléotides matrices précédemment appariés à la dernière amorce ne soient pas répliqués. [5] Il a depuis été demandé si la dernière amorce de brin retardé est placée exactement à l'extrémité 3' de la matrice et il a été démontré qu'elle est plutôt synthétisée à une distance d'environ 70-100 nucléotides, ce qui est cohérent avec la découverte que l'ADN dans les cellules humaines cultivées est raccourci de 50 à 100 paires de bases par division cellulaire. [6]

Si les séquences codantes sont dégradées au cours de ce processus, le code génétique potentiellement vital serait perdu. Les télomères sont des séquences répétitives non codantes situées aux extrémités des chromosomes linéaires pour agir comme tampons pour les séquences codantes situées plus loin. Ils « coiffent » les séquences terminales et se dégradent progressivement au cours du processus de réplication de l'ADN.

Le "problème de réplication terminale" est exclusif aux chromosomes linéaires, car les chromosomes circulaires n'ont pas d'extrémités sans portée des ADN-polymérases. La plupart des procaryotes, s'appuyant sur des chromosomes circulaires, ne possèdent donc pas de télomères. [7] Une petite fraction des chromosomes bactériens (comme ceux Streptomyces, Agrobactérie, et Borrelia), cependant, sont linéaires et possèdent des télomères très différents de ceux des chromosomes eucaryotes en termes de structure et de fonction. Les structures connues des télomères bactériens prennent la forme de protéines liées aux extrémités des chromosomes linéaires, ou de boucles en épingle à cheveux d'ADN simple brin aux extrémités des chromosomes linéaires. [8]

Les télomères se terminent et s'abritent Modifier

À l'extrémité 3' du télomère, il y a un surplomb de 300 paires de bases qui peut envahir la partie double brin du télomère formant une structure connue sous le nom de boucle en T. Cette boucle est analogue à un nœud, qui stabilise le télomère et empêche les extrémités des télomères d'être reconnues comme des points de rupture par la machinerie de réparation de l'ADN. Si une jonction d'extrémités non homologues se produisait aux extrémités télomériques, il en résulterait une fusion chromosomique. La boucle en T est maintenue par plusieurs protéines, appelées collectivement le complexe de l'abritine. Chez l'homme, le complexe de l'abritine se compose de six protéines identifiées comme TRF1, TRF2, TIN2, POT1, TPP1 et RAP1. [9] Chez de nombreuses espèces, les séquences répétées sont enrichies en guanine, par ex. TTAGGG chez les vertébrés, [10] qui permet la formation de G-quadruplexes, une conformation spéciale de l'ADN impliquant un appariement de bases non Watson-Crick. Il existe différents sous-types en fonction de l'implication d'ADN simple ou double brin, entre autres. Il existe des preuves que le surplomb 3' chez les ciliés (qui possèdent des répétitions de télomères similaires à celles trouvées chez les vertébrés) forment de tels quadruplexes G qui l'accommodent, plutôt qu'une boucle en T. Les G-quadruplexes représentent un obstacle pour les enzymes telles que les ADN-polymérases et seraient donc impliqués dans la régulation de la réplication et de la transcription. [11]

Télomérase Modifier

De nombreux organismes ont une enzyme appelée télomérase, qui effectue la tâche d'ajouter des séquences nucléotidiques répétitives aux extrémités de l'ADN. La télomérase « reconstitue » le « capuchon » des télomères. Dans la plupart des organismes eucaryotes multicellulaires, la télomérase n'est active que dans les cellules germinales, certains types de cellules souches telles que les cellules souches embryonnaires et certains globules blancs. La télomérase peut être réactivée et les télomères remis à l'état embryonnaire par transfert nucléaire de cellules somatiques. [12] Le raccourcissement constant des télomères à chaque réplication dans les cellules somatiques (corps) peut avoir un rôle dans la sénescence [13] et dans la prévention du cancer. [14] [15] C'est parce que les télomères agissent comme une sorte de "fusible" à retardement, finissant par s'épuiser après un certain nombre de divisions cellulaires et entraînant la perte éventuelle d'informations génétiques vitales du chromosome de la cellule avec les divisions futures . [16]

Longueur Modifier

La longueur des télomères varie considérablement d'une espèce à l'autre, d'environ 300 paires de bases chez la levure [17] à plusieurs kilobases chez l'homme, et est généralement composée de séries de répétitions riches en guanine, longues de six à huit paires de bases. Les télomères eucaryotes se terminent normalement par un surplomb d'ADN simple brin 3', ce qui est essentiel pour le maintien et le coiffage des télomères. Plusieurs protéines liant l'ADN des télomères simple et double brin ont été identifiées. [18] Ceux-ci fonctionnent à la fois dans le maintien et le coiffage des télomères. Les télomères forment de grandes structures en boucle appelées boucles de télomères ou boucles en T. Ici, l'ADN simple brin s'enroule en un long cercle, stabilisé par des protéines de liaison aux télomères. [19] À la toute fin de la boucle en T, l'ADN télomérique simple brin est maintenu sur une région d'ADN double brin par le brin télomérique perturbant l'ADN double hélice et l'appariement de bases à l'un des deux brins. Cette structure triple brin est appelée boucle de déplacement ou boucle D. [20]

Rôle dans le cycle cellulaire Modifier

Le raccourcissement des télomères chez l'homme peut induire une sénescence réplicative, qui bloque la division cellulaire. Ce mécanisme semble prévenir l'instabilité génomique et le développement du cancer dans les cellules humaines âgées en limitant le nombre de divisions cellulaires. Cependant, les télomères raccourcis altèrent la fonction immunitaire, ce qui pourrait également augmenter la susceptibilité au cancer. [21] Si les télomères deviennent trop courts, ils ont le potentiel de se déployer à partir de leur structure fermée présumée. La cellule peut détecter ce décapage comme un dommage à l'ADN, puis arrêter de croître, entrer dans la vieillesse cellulaire (sénescence) ou commencer l'autodestruction cellulaire programmée (apoptose) en fonction du patrimoine génétique de la cellule (statut p53). Les télomères non coiffés entraînent également des fusions chromosomiques. Étant donné que ces dommages ne peuvent pas être réparés dans les cellules somatiques normales, la cellule peut même entrer en apoptose. De nombreuses maladies liées au vieillissement sont liées à des télomères raccourcis. Les organes se détériorent à mesure que de plus en plus de leurs cellules meurent ou entrent en sénescence cellulaire.

Dommages oxydatifs Modifier

Outre le problème de réplication finale, des études in vitro ont montré que les télomères accumulent des dommages dus au stress oxydatif et que les dommages à l'ADN induits par le stress oxydatif ont une influence majeure sur le raccourcissement des télomères in vivo. Il existe une multitude de façons dont le stress oxydatif, médié par les espèces réactives de l'oxygène (ROS), peut entraîner des dommages à l'ADN. systèmes de réparation dans ces régions. [22] Malgré un large accord sur les résultats, des défauts généralisés concernant la mesure et l'échantillonnage ont été signalés, par exemple, une espèce suspectée et une dépendance tissulaire des dommages oxydatifs aux télomères seraient insuffisamment prises en compte. [23] Des études basées sur la population ont indiqué une interaction entre l'apport d'antioxydants et la longueur des télomères. Dans le Long Island Breast Cancer Study Project (LIBCSP), les auteurs ont trouvé une augmentation modérée du risque de cancer du sein chez les femmes ayant les télomères les plus courts et un apport alimentaire plus faible en bêta-carotène, vitamine C ou E. [24] Ces résultats [25] suggèrent que Le risque de cancer dû au raccourcissement des télomères peut interagir avec d'autres mécanismes d'endommagement de l'ADN, en particulier le stress oxydatif.

Association avec le vieillissement Modifier

Le raccourcissement des télomères est associé au vieillissement, à la mortalité et aux maladies liées au vieillissement. Le vieillissement normal est associé au raccourcissement des télomères chez les humains et les souris, et des études sur des modèles animaux génétiquement modifiés suggèrent des liens de causalité entre l'érosion des télomères et le vieillissement. [26] Cependant, on ne sait pas si les télomères courts ne sont qu'un symptôme de la sénescence ou s'ils contribuent eux-mêmes à la progression du processus de vieillissement. [27]

L'âge d'un père joue un rôle dans la longueur des télomères d'un enfant, ce qui a des implications évolutives. Bien que les télomères des leucocytes raccourcissent avec l'âge, les télomères des spermatozoïdes s'allongent avec l'âge. Des télomères plus courts sont théorisés pour imposer des coûts énergétiques inférieurs (en raison de moins de réplication) mais ont également des coûts liés au système immunitaire et à d'autres coûts liés au vieillissement et à la maladie, de sorte que l'effet de l'âge paternel sur la longueur des télomères pourrait être une adaptation pour augmenter les chances que l'enfant sera adapté à l'environnement dans lequel il est né. [28] [29]

Effet potentiel du stress psychologique Modifier

Des méta-analyses ont révélé qu'une augmentation du stress psychologique perçu était associée à une légère diminution de la longueur des télomères, mais que ces associations s'atténuent jusqu'à l'absence d'association significative lorsque l'on tient compte du biais de publication. La littérature concernant les télomères en tant que biomarqueurs intégratifs de l'exposition au stress et à l'adversité est dominée par des études transversales et corrélationnelles, ce qui rend l'interprétation causale problématique. [25] [30] Une revue de 2020 a fait valoir que la relation entre le stress psychosocial et la longueur des télomères semble la plus forte pour le stress vécu in utero ou au début de la vie. [31]

Le phénomène de division cellulaire limitée a été observé pour la première fois par Leonard Hayflick, et est maintenant appelé la limite de Hayflick. [32] [33] Des découvertes significatives ont été faites par la suite par un groupe de scientifiques organisé à Geron Corporation par le fondateur de Geron Michael D. West, qui a lié le raccourcissement des télomères à la limite de Hayflick. [34] Le clonage de la composante catalytique de la télomérase a permis aux expériences de tester si l'expression de la télomérase à des niveaux suffisants pour empêcher le raccourcissement des télomères était capable d'immortaliser les cellules humaines. La télomérase a été démontrée dans une publication de 1998 dans Science être capable de prolonger la durée de vie des cellules, et est maintenant reconnu comme capable d'immortaliser les cellules somatiques humaines. [35]

Il devient évident que l'inversion du raccourcissement des télomères par l'activation temporaire de la télomérase peut être un moyen puissant de ralentir le vieillissement. La raison pour laquelle cela prolongerait la vie humaine est que cela augmenterait la limite de Hayflick. Trois voies ont été proposées pour inverser le raccourcissement des télomères : les médicaments, la thérapie génique ou la suppression métabolique, appelée torpeur/hibernation. Jusqu'à présent, ces idées n'ont pas été prouvées chez l'homme, mais il a été démontré que le raccourcissement des télomères est inversé pendant l'hibernation et que le vieillissement est ralenti (Turbill, et al. 2012 et 2013) et que l'hibernation prolonge la durée de vie (Lyman et al. 1981). Il a également été démontré que l'extension des télomères a réussi à inverser certains signes de vieillissement chez les souris de laboratoire [36] [37] et les espèces de vers nématodes Caenorhabditis elegans. [38] Il a été émis l'hypothèse que des télomères plus longs et en particulier l'activation de la télomérase pourraient provoquer une augmentation du cancer (par exemple, Weinstein et Ciszek, 2002 [39] ). Cependant, des télomères plus longs pourraient également protéger contre le cancer, car les télomères courts sont associés au cancer. Il a également été suggéré que des télomères plus longs pourraient entraîner une augmentation de la consommation d'énergie. [21]

Les techniques d'extension des télomères pourraient être utiles pour l'ingénierie tissulaire, car elles pourraient permettre la culture de cellules de mammifères saines et non cancéreuses en quantités suffisamment importantes pour constituer des matériaux d'ingénierie pour les réparations biomédicales.

Deux études sur les oiseaux marins longévives démontrent que le rôle des télomères est loin d'être compris. En 2003, des scientifiques ont observé que les télomères de l'océanite de Leach (Oceanodroma leucorhoa) semblent s'allonger avec l'âge chronologique, premier exemple observé d'un tel comportement des télomères. [40] En 2006, Juola et al. [41] ont rapporté que chez une autre espèce d'oiseau de mer non apparentée et à longue durée de vie, la grande frégate (Frégate mineure), la longueur des télomères a diminué jusqu'à au moins c. 40 ans (c. Ils ont conclu que chez cette espèce (et probablement chez les frégates et leurs parents en général), la longueur des télomères ne pouvait pas être utilisée pour déterminer suffisamment bien l'âge d'un oiseau. Ainsi, il semble qu'il y ait beaucoup plus de variation dans le comportement de la longueur des télomères qu'on ne le croyait initialement.

De plus, Gomes et al. ont trouvé, dans une étude de la biologie comparative des télomères de mammifères, que la longueur des télomères de différentes espèces de mammifères est en corrélation inverse, plutôt que directement, avec la durée de vie, et ils ont conclu que la contribution de la longueur des télomères à la durée de vie reste controversée. [42] Harris et al. ont trouvé peu de preuves que, chez l'homme, la longueur des télomères est un biomarqueur significatif du vieillissement normal en ce qui concerne les capacités cognitives et physiques importantes. [43] Gilley et Blackburn ont testé si la sénescence cellulaire dans la paramécie est causée par le raccourcissement des télomères et ont constaté que les télomères n'étaient pas raccourcis pendant la sénescence. [44]

Les séquences nucléotidiques des télomères connues et à jour sont répertoriées sur le site Web de la base de données de la télomérase.

Quelques séquences de nucléotides télomériques connues
Grouper Organisme Répétition télomérique (5' à 3' vers la fin)
Vertébrés Humain, souris, Xénope TTAGGG
Champignons filamenteux Neurospora crassa TTAGGG
Moules à boue Physarum, Didyme TTAGGG
Dictyostelium AG(1-8)
Protozoaires kinétoplastides Trypanosome, Crithidia TTAGGG
Protozoaires ciliés Tétrahymène, Glaucome TTGGGG
Paramécie TTGGG(T/G)
Oxytricha, Stylonychie, Euplotes TTTTGGGG
Protozoaires apicomplexes Plasmodium TTAGGG(T/C)
Plantes supérieures Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG [45]
Allium CTCGGTTATGGG [46]
Les algues vertes Chlamydomonas TTTTAGGG
Insectes Bombyx mori TTAGG
Vers ronds Ascaris lumbricoides TTAGGC
Levures de fission Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Levures bourgeonnantes Saccharomyces cerevisiae TGTGGGTGTGGTG (à partir de la matrice d'ARN)
ou G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida Guillermondii GGTGTAC
Candida pseudotropical GGGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGGTACGGATTTGATTAGGTATGT

Les télomères sont essentiels au maintien de l'intégrité génomique et peuvent être des facteurs de maladies liées à l'âge. [47] Des études de laboratoire montrent que le dysfonctionnement ou le raccourcissement des télomères est généralement dû au processus de vieillissement cellulaire et de développement tumoral. [47] [48] Les télomères courts peuvent entraîner une instabilité génomique, une perte de chromosomes et la formation de translocations et de télomères non réciproques dans les cellules tumorales et leurs lésions précurseurs sont significativement plus courtes que le tissu normal environnant. [49] [50]

Des études observationnelles ont trouvé des télomères raccourcis dans de nombreux types de cancers expérimentaux. [51] De plus, il a été découvert que les personnes atteintes de cancer possèdent des télomères leucocytaires plus courts que les témoins sains. [52] Des méta-analyses récentes suggèrent un risque accru de cancer de 1,4 à 3,0 fois chez les personnes ayant les télomères les plus courts par rapport aux plus longs. [53] [54] Cependant, l'augmentation du risque varie selon l'âge, le sexe, le type de tumeur et les différences dans les facteurs liés au mode de vie. [51]

Plusieurs techniques sont actuellement utilisées pour évaluer la longueur moyenne des télomères dans les cellules eucaryotes. Une méthode est le Southern Blot (TRF) du fragment de restriction terminal. [55] [56] Un test PCR en temps réel pour la longueur des télomères consiste à déterminer le rapport télomères à copie unique (T/S), dont il est démontré qu'il est proportionnel à la longueur moyenne des télomères dans une cellule. [57]

Des outils ont également été développés pour estimer la longueur des télomères à partir d'expériences de séquençage du génome entier (WGS). Parmi ceux-ci figurent TelSeq, [58] telomereCat [59] et telomereHunter. [60] L'estimation de la longueur à partir de WGS fonctionne généralement en différenciant les lectures de séquençage des télomères, puis en déduisant la longueur des télomères qui a produit ce nombre de lectures. Il a été démontré que ces méthodes sont en corrélation avec des méthodes d'estimation préexistantes telles que la PCR et la TRF. Flow-FISH est utilisé pour quantifier la longueur des télomères dans les globules blancs humains. Une méthode semi-automatisée de mesure de la longueur moyenne des télomères avec Flow FISH a été publiée dans Nature Protocols en 2006. [61]

Alors que plusieurs entreprises proposent des services de mesure de la longueur des télomères, l'utilité de ces mesures pour un usage clinique ou personnel généralisé a été remise en question. [62] [63] La lauréate du prix Nobel Elizabeth Blackburn, co-fondatrice d'une entreprise, a promu l'utilité clinique des mesures de la longueur des télomères. [64]

La plupart des recherches sur la longueur et la régulation des télomères, et leur relation avec le cancer et le vieillissement, ont été effectuées sur des mammifères, en particulier des humains, qui ont peu ou pas de production de télomérase somatique. Les ectothermes sont significativement plus susceptibles que les endothermes d'avoir une variation dans l'expression de la télomérase somatique. Par exemple, chez de nombreux poissons, la télomérase se produit dans tout le corps (et associée à cela, la longueur des télomères est à peu près la même dans tous ses tissus). Des études sur les ectothermes et d'autres organismes non mammifères montrent qu'il n'y a pas de modèle universel unique d'érosion des télomères, il existe plutôt une grande variation dans la dynamique pertinente à travers les métazoaires, et même au sein de groupes taxonomiques plus petits, ces modèles semblent divers. En raison des différents calendriers de reproduction de certains ectothermes, la sélection sur la maladie est pertinente pour une fraction beaucoup plus grande de la vie de ces créatures que pour les mammifères, donc la longueur des télomères au début et à la fin de la vie, et leurs liens possibles avec le cancer, semblent particulièrement important chez ces espèces du point de vue de la théorie de l'histoire de la vie. [65]


Locomotion et mouvement Questions supplémentaires importantes Type de réponse très courte

Question 1.
Qu'est-ce qu'un tendon ?
Réponse:
Le tissu conjonctif dense relie les os et les muscles squelettiques.

Question 2.
Quels sont les muscles antagonistes?
Réponse:
Les. paire de muscles qui à une articulation produisent des mouvements opposés.

Question 3.
Qu'est-ce que le tétanos ?
Réponse:
L'état continu de contraction musculaire est appelé tétanos.

Question 4.
Qu'est-ce qu'un stimulus seuil ?
Réponse:
Le stimulus de force minimale qui est requis pour provoquer la contraction musculaire est appelé stimulus de seuil.

Question 5.
Qu'est-ce qu'une contraction musculaire ?
Réponse:
La contraction unique du muscle lors de la réception du stimulus est appelée contraction musculaire. (La contraction est suivie d'une relaxation).

Question 6.
Qu'est-ce que le sarcomère ?
Réponse:
L'unité fonctionnelle de la myofibrille se contracte et provoque le raccourcissement de la fibre musculaire.

Question 7.
Combien d'os sont présents dans le squelette humain ?
Réponse:
Le squelette humain contient 206 os.

Question 8.
Que sont les articulations synoviales ?
Réponse:
Ce sont des articulations librement mobiles en raison de la présence de liquide synovial dans la cavité synoviale.

Question 9.
Qu'est-ce que la locomotion ?
Réponse:
Le mouvement corporel chez les animaux d'un endroit à l'autre s'appelle la locomotion.

Question 10.
Qu'est-ce que la rigor mortis ?
Réponse:
Raideur musculaire après la mort.

Question 11.
Nommez les protéines qui aident à la contraction musculaire.
Réponse:
Myosine et actine.

Question 12.
Quelle est la fonction du liquide synovial ?
Réponse:
Le liquide synovial agit comme un lubrifiant.

Question 13.
Qu'est-ce qu'une articulation pivot ?
Réponse:
L'articulation permet les mouvements de rotation ou de rotation, par exemple, entre l'atlas et l'axe vertébral.

Question 14.
Laquelle des articulations mobiles fait l'articulation de la hanche ?
Réponse:
Articulation à rotule et à douille.

Question 15.
Quel muscle se contracte pour que votre paume soit tournée vers le haut ?
Réponse:
Supinateur.

Question 16.
Combien d'os y a-t-il dans le crâne humain ?
Réponse:
29

Question 17.
Quel type d'articulation mobile est l'articulation du genou ?
Réponse:
Articulation de charnière.

Question 18.
Nommez la bande de l'articulation squelettique qui permet les mouvements dans un seul plan.
Réponse:
Articulation de charnière.

Question 19.
Faites la différence entre la bande A et la bande I.
Réponse:

  • La bande A est une bande sombre contenant des filaments de myosine.
  • La bande I est une bande lumineuse ayant des filaments fins.

Question 20.
Quel est le nombre total d'os dans notre corps?
Réponse:
206.

Question 21.
Nommez les cinq catégories différentes de vertèbres de votre colonne vertébrale.
Réponse:

Question 20.
Où à l'intérieur des os sont produites les cellules sanguines?
Réponse:
La moelle osseuse des os longs.

Question 23.
Donnez un exemple de joint à rotule.
Réponse:
Articulation de l'épaule.

Locomotion et mouvement Questions supplémentaires importantes Type de réponse courte

Question 1.
Énumérez la fonction mécanique du squelette.
Réponse:

  1. Il fournit un cadre rigide du corps et une forme définie aux organes.
  2. Il supporte le poids du corps.
  3. Il protège les organes internes.
  4. Ses os longs fonctionnent comme un levier.
  5. Les muscles squelettiques avec des bandes de tissu conjonctif flexibles appelés tendons en association avec l'endosquelette et les articulations donnent la locomotion et les mouvements à différentes parties du corps.

Question 2.
Énumérez certaines fonctions biologiques du squelette.
Réponse:

  1. Fournit une surface d'attache aux muscles.
  2. Sert de dépôt de stockage de minéraux de calcium et de phosphate.
  3. Agir dans l'érythropoïèse.
  4. Les osselets de l'oreille aident à la propagation des ondes sonores.
  5. La moelle osseuse rouge présente à l'intérieur de la cavité médullaire des os longs tels que le fémur, l'humérus et dans les interstices des os spongieux des vertèbres, du sternum, de l'omoplate, etc. aide à la formation de globules rouges, de globules blancs et de plaquettes sanguines. Ce processus est connu sous le nom d'hémopoïèse.

Question 3.
Énumérez les différents modes de locomotion et de déplacement dans l'hydre.
Réponse:

  1. Contraction et expansion
  2. Se pencher et se balancer
  3. Bouclage
  4. Faire des sauts périlleux.
  5. Flottant
  6. Glissement
  7. Nager
  8. Marche à pied.

Question 4.
Quelles sont les différentes molécules présentes dans les muscles ?
Réponse:

  1. Protéines contractiles à savoir. actine, myosine et tropomyosine.
  2. Enzymes et autres protéines comme la troponine.
  3. Les glucides comme substrat énergétique.
  4. L'énergie porte à savoir. ATP, ADP, AMP et CP.
  5. Ions à savoir. Na + , K + , Mg ++ , Ca + , CI + .

Question 5.
Différencier contraction isotonique et isométrique
Réponse:

Contraction isotonique Contraction isométrique
1. Il y a un changement dans la forme des muscles. 1. Il n'y a pas de changement dans la forme des muscles
2. Les muscles maintiennent la tension. 2. Les muscles maintiennent la longueur.
3. Les muscles se contractent et la charge est soulevée 3. Les muscles se contractent contre une charge qui ne peut pas être soulevée.

Question 6.
Une fibre musculaire rouge travaille pendant une période prolongée, alors qu'une fibre musculaire blanche se fatigue, pourquoi ?
Réponse:
Les fibres musculaires rouges contiennent de la myoglobine, un pigment stockant de l'oxygène et un grand nombre de mitochondries, de sorte qu'elles peuvent avoir de l'O2 l'approvisionnement pour la respiration aérobie et la libération d'énergie pendant une période plus longue.

Les fibres musculaires blanches n'ont pas de pigment de myoglobine. Ils sont confrontés à une pénurie d'O2 et beaucoup dépend de la respiration anaérobie, donc ils se fatiguent rapidement.

Question 7.
Quels sont les principaux types d'articulations présentes dans le corps humain ?
Réponse:
Les types d'articulations présentes dans le corps de l'homme sont :
1. Articulations fixes ou fibreuses : Il n'y a aucun mouvement dans les articulations articulées, en raison de la présence de tissu fibreux blanc dur, inextensible, par exemple les os du crâne.

2. Articulations légèrement mobiles ou cartilagineuses : Un mouvement limité est possible dans les os articulés. Un disque dense de cartilage blanc rejoint les surfaces articulaires, par exemple les vertèbres et la symphyse publique.


Différents types d'articulations

3. Articulations librement mobiles ou synoviales : la libre circulation est possible en raison de la présence de liquide synovial dans la cavité synoviale, entre les os de l'articulation, par exemple, l'articulation de la charnière, l'articulation sphérique.

Question 8.
Quels sont les avantages du mouvement des parties du corps ?
Réponse:
Le mouvement présente les avantages suivants :

  1. Avec un changement de posture corporelle et de mouvement des membres, l'équilibre du corps est maintenu.
  2. Le mouvement des membres provoque la locomotion.
  3. La nourriture est capturée par le mouvement des tentacules, des membres, de la mâchoire, de la langue, etc. chez différents animaux.
  4. Les changements dans l'environnement environnant peuvent être détectés par le mouvement du globe oculaire, du pavillon, etc.
  5. La circulation sanguine est possible par le mouvement du cœur.
  6. Le mouvement du diaphragme provoque l'inspiration et l'expiration (respiration).

Question 9.
Quels sont les avantages de la locomotion ?
Réponse:
Les mouvements corporels ou la locomotion présentent les avantages suivants :

  1. Il permet au corps de le déplacer entièrement d'un endroit à l'autre.
  2. Il protège l'organisme de la prédation.
  3. Il aide les animaux à faire la recherche de leur nourriture et d'autres besoins nutritionnels.
  4. Il aide l'animal à chercher un partenaire pour la reproduction.

Question 10.
Dessinez un diagramme étiqueté de l'articulation trouvée entre la ceinture pelvienne et le fémur. Ecrivez également le type de ce joint.
Réponse:
Type d'articulation : L'articulation entre les os du bassin et du fémur est une articulation synoviale à rotule.

Articulation sphérique synoviale entre le bassin et le fémur

Question 11.
Pourquoi le mouvement et la locomotion sont nécessaires chez les animaux ?
Réponse:
Le mouvement et la locomotion sont nécessaires chez les animaux pour leur survie. Il leur permet de se procurer de la nourriture, de chercher un abri, de trouver des partenaires, de se protéger des prédateurs et d'effectuer de nombreuses autres activités de la vie.

Question 12.
Élucider les types de mouvements trouvés chez les animaux.
Réponse:
Les mouvements entre les animaux varient considérablement. Le mouvement implique trois mécanismes de base.
Ceux-ci sont:

Le mouvement amiboïde est typique d'Amoeba. L'amibe se déplace à l'aide de pseudopodes. Le mouvement amiboïde aide également à la capture de la nourriture et au changement de lieu.

La même méthode de mouvement est également utilisée par les leucocytes, comme les phagocytes et les macrophages du système lymphatique humain pour l'engloutissement de l'antigène et la migration du liquide circulatoire. Chez les protozoaires, un mouvement ciliaire est observé. Le mouvement musculaire est le mécanisme de base utilisé chez la majorité des vertébrés, y compris les humains. La plupart des animaux multicellulaires possèdent des fibres musculaires pour le mouvement de différents organes et la locomotion.

Question 13.
Qu'est-ce que le muscle ? Écrivez les noms des différents types de muscles?
Réponse:
La locomotion chez l'homme dépend des mouvements des fibres musculaires (cellules musculaires). Les muscles sont constitués de fibres contractiles qui à leur tour sont formées de myofibrilles. Chez l'homme, les muscles représentent près de 40 % à 50 % du poids corporel total.

Les muscles sont généralement classés en trois catégories.

  1. Muscles squelettiques : Ceux-ci sont attachés aux os par des tendons et aident au mouvement de la partie du squelette. Ces muscles sont sous le contrôle de l'esprit conscient et peuvent être déplacés vers le mur.
    Les muscles squelettiques sont appelés muscles volontaires.
  2. Muscles cardiaques : ceux-ci sont également striés et se produisent exclusivement sur le cœur.
  3. Muscles lisses : Ce sont des muscles involontaires et non striés et sont innervés par le système nerveux autonome.

Question 14.
Comment le muscle squelettique se contracte-t-il ?
Réponse:
Pendant la contraction, les filaments d'actine et de myosine glissent les uns sur les autres pour réduire la longueur des sarcomères. Les filaments d'actine se déplacent vers l'intérieur vers le centre du sarcomère. Les têtes des filaments de myosine fonctionnent comme des « crochets » et s'attachent à la F-actine, elles forment des ponts croisés, puis changent de configuration relative et tirent les filaments d'actine.

En conséquence, les lignes Z limitant les sarcomères sont rapprochées, mais la longueur des bandes A reste inchangée. Les bandes I réduisent en longueur.

Cependant, le résultat net est le raccourcissement du sarcomère. Le filament d'actine glisse hors de la bande A, ce qui entraîne l'allongement du sarcomère.

Question 15.
Qu'est-ce que l'arthrite? Comment est-ce causé?
Réponse:
Il s'agit d'un trouble des os dans lequel les tissus fibreux sont attachés aux os et s'ossifient, rendant les articulations immobiles.

Elle est causée par l'inflammation des articulations. Il s'agit de plusieurs types, par exemple, la polyarthrite rhumatoïde, l'arthrose et l'arthrite goutteuse.

Question 16.
Écrivez les noms des facteurs qui sont responsables de l'ostéoporose.
Réponse:
Les déséquilibres d'hormones comme la thyrocalcitonine, les hormones parathyroïdiennes et sexuelles, les carences en calcium et en vitamine D sont les principaux causatifs.

Question 17.
Comment les articulations aident-elles au mouvement? Expliquer.
Réponse:
Une articulation synoviale ou mobile est une articulation qui permet le mouvement des os de manière à ce qu'ils puissent se déplacer largement les uns sur les autres. Dans les articulations, il existe un espace appelé cavité synoviale. Cette cavité reste remplie d'un liquide appelé liquide synovial.

Le mouvement d'un organe se produit en raison de la traction des os. Le mouvement a lieu le long des articulations qui agissent comme le pivot du foie. En fait, les articulations fonctionnent comme un levier. En raison de la présence d'un certain nombre d'articulations, le mouvement des différentes parties du corps et de tout le corps est possible.

Question 18.
Comment le calcium affecte le processus de contraction musculaire ?
Réponse:
Les fibres musculaires sont excitables. Normalement, une impulsion nerveuse arrivant à la jonction neuromusculaire initie une réponse contractile. Un neurotransmetteur libéré à la jonction neuromusculaire pénètre dans le sarcomère par son canal membranaire. L'ouverture du canal entraîne également l'afflux de Na+ à l'intérieur du sarcomère et génère un potentiel d'action dans la fibre musculaire.

Le réticulum sarcoplasmique libère le Ca ++ stocké, qui se lie aux sites spécifiques présents sur le composant troponine du filament mince. En conséquence, les sites actifs présents sur les molécules d'actine F sont exposés. Ces sites sont spécifiques de la tête de myosine, qui présente comme activité l'ATP dépendant de Mg++.

Lors de la relaxation du muscle, le Ca ++ est renvoyé dans le réticulum sarcoplasmique. En conséquence, le composant troponine devient libre. Le pont croisé se brise et le filament fin occupe sa position normale. Le muscle se détend.

Question 19.
Écrivez la différence entre les articulations mobiles et les articulations immobiles.
Réponse:

Articulations mobiles Articulations immobiles
1. Les surfaces articulaires sont maintenues en contact étroit par une capsule fibreuse et un liquide synovial glissant se forme dans l'espace entre les surfaces articulaires de l'os. 1. Les os articulés de cette articulation sont fermement maintenus ensemble par des bandes denses de tissu fibreux blanc inextensible et résistant.
2. Il permet un mouvement considérable des os de l'articulation. 2. Il ne permet aucun mouvement des os de l'articulation.

Question 20.
Remplir les espaces vides:
Réponse:

  1. La troponine fait partie du filament de myosine.
  2. La tête de la myosine a une activité passive AT.
  3. Les os du rayon humérus et du cubitus se trouvent dans l'avant-bras.
  4. Le cotyle est présent dans la ceinture pelvienne.
  5. Le joint à rotule est une ceinture mobile.

Question 21.
Faire correspondre la colonne I avec la colonne II

Colonne I Colonne - II
(a) Muscle lisse (i) Myoglobine
(b) Tropomyosine (ii) Levier de troisième classe
(c) Muscle rouge (iii) Filament fin
(d) Crâne (iv) Sutures
(e) Avant-bras (v) Involontaire

Colonne I Colonne - II
(a) Muscle lisse (v) Involontaire
(b) Tropomyosine (iii) Filament fin
(c) Muscle rouge (i) Myoglobine
(d) Crâne (iv) Sutures
(e) Avant-bras (ii) Levier de troisième classe

Question 22.
Qu'est-ce qu'un joint ? Écrivez son type avec un exemple.
Réponse:
Les articulations sont le lieu d'articulation entre deux ou plusieurs os ou entre un os et un cartilage. En raison de la présence d'un certain nombre d'articulations, le mouvement des différentes parties du corps et de l'ensemble du corps est possible.

Il existe trois types d'articulations :

  1. Articulations fixes ou immobiles : Il n'y a pas d'espace entre les os. Ils sont attachés très étroitement à l'aide de tissu conjonctif fibreux blanc.
  2. Légèrement mobile ou cartilagineux : C'est une articulation entre les os qui permet un très petit mouvement.
  3. Articulations mobiles ou synoviales : C'est une articulation qui permet le mouvement des os articulés de telle sorte qu'ils puissent se déplacer largement les uns sur les autres. Dans de telles articulations, une vanité synoviale est présente.

Question 23.
Quel est le rôle de la ceinture dans le squelette ?
Réponse:
Les os de la ceinture assurent une connexion entre le squelette axial et les membres. Les deux ceintures sont nommées ceintures pectorales et pelviennes. Chaque ceinture est formée de deux moitiés.

Locomotion et mouvement Questions supplémentaires importantes Type de réponse longue

Question 1.
(a) Au cours de la contraction musculaire, quels sont les changements chimiques qui se produisent. Décrivez sous une forme répertoriée.
Réponse:
Les principaux événements chimiques qui se produisent lors de la contraction musculaire décrits par Albert Szent Gyorgi sont
1. L'acétylcholine est libérée des vésicules à la jonction neuromusculaire. Il stimule le muscle.

2. Hydrolyse de l'ATP en présence de Ca ++ et Mg ++ Énergie consommée lors de la contraction musculaire.

3. L'ADP est rechargé en prenant du phosphate de créatine phosphate (CP).

4. Pendant la relaxation, la créatine est phosphorylée, l'énergie étant fournie par la conversion anaérobie du glycogène musculaire en acide lactique.
Créatine + ATP — Création-phosphate + ADP

5. L'énergie libérée par l'hydrolyse de l'ATP provoque la rotation des têtes de myosine et rapproche les filaments d'actine, le complexe d'actomyosine se forme, finalement, le sarcomère se raccourcit.

6. Ca ++ est activement transporté vers le réticulum sarcoplasmique, plus de Ca ++ disponible pour la dégradation de l'ATP, plus d'énergie disponible pour une contraction ultérieure du sarcomère.

7. Une partie de l'énergie est utilisée en cassant des ponts transversaux et le muscle se détend.

(b) Quels sont les principaux groupes de vertèbres de la colonne vertébrale de l'homme ?
Réponse:
Il existe 5 groupes de vertèbres à savoir cervicale, thoracique, lombaire, sacrée et coccygienne.
(La formule vertébrale est C7, T12, L5, C3-5 = 32 – 34).

Question 2.
(a) A quoi sert le mouvement des parties externes du corps par rapport à l'axe du corps chez les animaux ?
Réponse:

  1. Le mouvement des membres, des appendices, de la tête et du tronc sert à modifier la posture du corps pour maintenir l'équilibre contre la gravité.
  2. Les mouvements des membres sont des conditions préalables à la réalisation de la locomotion.
  3. La préhension de la nourriture implique le mouvement de la langue, des mâchoires, du museau, des tentacules, des membres et des appendices chez différents animaux.
  4. Le mouvement des globes oculaires et du pavillon de l'oreille aide à collecter des informations de l'environnement extérieur.

(b) Que sont les articulations fibreuses et cartilagineuses et leur fonction biologique ?
Réponse:

  1. Articulation fibreuse : Les os articulés sont fermement maintenus ensemble par les bandes denses de tissus fibreux blancs inextensibles et résistants. Ils assurent la résistance et le soutien du corps ou la protection des structures délicates qui ne peuvent supporter aucune déformation.
  2. Articulations cartilagineuses : Dans les articulations cartilagineuses, un disque dense de fibrocartilage blanc relie les surfaces opposées des os articulés les unes aux autres. Cela permet un mouvement limité au niveau des articulations.

(c) Expliquez les muscles antagonistes.
Réponse:
Muscles antagonistes : Les muscles antagonistes sont ceux qui se contractent pour produire des mouvements opposés au niveau de la même articulation. Lorsqu'un muscle se contracte pour produire un mouvement, son antagoniste doit se détendre pour permettre à ce mouvement d'avoir lieu, par exemple, le biceps est un FLEXER pour l'articulation du coude et le triceps est un antagoniste et un EXTENSEUR pour cette articulation.

Lors de la flexion du coude, le biceps se contracte et le triceps se relâche, lors de l'extension au niveau de la même articulation le triceps se contracte et le biceps se détend.

(d) Distinguer les contractions musculaires du tétanos ou expliquer les contractions musculaires et le tétanos.
Réponse:
Une seule contraction isolée causée par une seule impulsion nerveuse ou un choc électrique est appelée contraction musculaire. Immédiatement après la brève contraction, les fibres musculaires se détendent.

Le tétanos est un état continu de concentration causé par de nombreux stimuli répétés. Une tension beaucoup plus élevée est développée dans le tétanos que dans une contraction isolée. Presque toutes nos activités quotidiennes sont réalisées par des contractions tétaniques des muscles.

Question 3.
Comment les filaments épais et minces sont-ils disposés dans une fibre musculaire ?

relation entre les filaments d'actine et de myosine dans les états étirés et contractés
Réponse:
Chaque muscle strié contient de fins filaments d'actine et d'épais filaments de myosine. Ces filaments sont disposés longitudinalement à l'intérieur des bandes I claires et des bandes A sombres respectivement. Les filaments d'actine et de myosine restent réticulés entre eux dans la myofibrille. Les sarcomères sont les rangées d'unités fonctionnelles dans chaque myofibrille, chacune s'étendant à partir de la ligne Z sombre de la bande I suivante. Chaque sarcomère comprend donc une bande A au milieu avec 2 demi-bandes I sur ses deux faces.

À partir de chaque ligne Z, les filaments d'actine à travers la moitié de la bande I se mélangent aux extrémités des filaments de myosine dans la bande A. La myofibrille est entourée à chaque bande I par les tubules et citernes du réticulum sarcoplasmique et à chaque jonction des bandes A et I par un tubule TI communiquant avec l'extérieur de la cellule, comme le montre la figure. La relation entre l'actine (filament fin) et la myosine (filament épais).


3 réponses 3

La réponse est oui, deux objets peuvent orbiter l'un autour de l'autre, y compris la Terre et Jupiter.

Vous devez vous préoccuper de la limite de Roche, qui vous indique à quelle distance ils doivent être pour le faire.

Et sachez que la gravité fonctionne dans les deux sens, même pour les objets plus petits : la Terre est entraînée dans une rotation par notre Lune tout comme notre Lune est entraînée dans une rotation par la Terre : ce ne sont pas seulement les marées déplacées par la Lune, mais le centre de la Terre se déplace en petits cercles à cause de la lune.

Ainsi, des planètes de masse égale s'entoureraient. Mais Jupiter est 318 fois la masse de la Terre, et la planète la plus massive connue dans l'Univers est environ 30 fois la masse de Jupiter. (FWIW notre Terre est 81 x notre Lune).

Recherchez la limite de Roche qui devrait également vous indiquer quelle devrait être votre orbite minimale autour de votre grande planète (mais l'orbite réelle peut être des milliers de fois plus grande).

Roche Limit dit que la Terre ne peut pas être à moins de 67 000 milles de Jupiter sans se briser. Cependant, votre planète peut être un peu plus loin, notre Lune est environ 40 fois supérieure à son corps rigide Roche Limite de la Terre. Mais cela signifie que vous pouvez le placer là où vous le souhaitez, il ne doit pas être extrêmement loin de la géante gazeuse. Si vous voulez le réchauffement de votre planète par les marées (et beaucoup de tremblements de terre), mettez-la à proximité si votre planète est chauffée autrement et que vous la voulez plus calme, je la garderais à au moins vingt unités Roche, disons à 1,4 million de miles de Jupiter.

Tu es mieux avec une lune habitable qu'une terra capturée. Un scénario serait une lune massive qui migrerait vers sa planète, tandis que la planète migrerait vers son soleil. La migration s'explique par le "rétrécissement" universel, donc c'est cohérent, et il n'y a pas de gant de receveur improbable ou de physique de billard nécessaire.

Le problème est que votre géante gazeuse et votre planète Terra ne se sont pas formées dans la même partie du système solaire. La pensée actuelle est qu'il y a une ligne de gel définissante créée lorsque la nébuleuse solaire s'est formée en planètes. À l'intérieur de la ligne de gel, vous obtenez les planètes terrestres rocheuses, au-delà se trouvent les géantes de gaz et de glace.

Une planète terra en migration est possible – renversée de son orbite par une brosse avec une autre planète, mais être ensuite doucement pincée par une géante gazeuse dans une orbite stable est improbable – comme frapper une balle de baseball à 10 000 milles pour atterrir doucement un gant de receveur. Vous ne voulez probablement pas que votre planète soit dans le système solaire extérieur, même si elle pourrait conserver son atmosphère pendant le billard cosmique.

Une géante gazeuse en migration est crédible car elle pourrait facilement migrer vers le soleil, mais alors qu'est-ce qui l'a empêchée de migrer – en supposant que votre planète Terra n'est pas entraînée dans une spirale de la mort ? La réponse serait une autre géante gazeuse encore plus grande sur une orbite de résonance, mais encore une fois, cet ensemble de circonstances ressemble à un billard cosmique improbable, impliquant maintenant trois planètes.

Les orbites de résonance sont instables, elles ne "déposent" pas un objet dans un sillon stable autant qu'elles projettent les autres corps au loin. Les définitions d'une planète sont la façon dont elles dégagent leur propre orbite de tous les autres objets (le rapport de résonance de 1: 1), et Jupiter est théorisé comme ayant été le gros bébé qui a jeté tous les jouets du landau. Au fur et à mesure que votre géante gazeuse s'approche du système intérieur, elle enverrait votre planète terra hors du système solaire bien avant qu'elle ne soit suffisamment proche pour être capturée.

Se faire capturer par une planète voyou semble également impossible, le voyou traverserait le système solaire à une vitesse de fuite. Cela ne va pas non plus accrocher doucement une planète.

Une lune habitable est le seul moyen raisonnable de se retrouver avec quelque chose de stable.

Mes recherches me disent qu'une lune autour d'une géante gazeuse n'est pas susceptible d'être plus grande que 1/10 000e de la masse de son parent.

La limite de masse théorique entre une planète et une naine brune est d'environ 13 masses de Jupiter, soit environ 4 131,4 fois la masse de la Terre. Ainsi, si une lune ne peut pas être plus de 0,0001 fois plus massive qu'une géante gazeuse, elle ne peut pas avoir plus de 0,41314 fois la masse de la Terre.

Jupiter a une masse de 317,8 de la Terre. Sa lune la plus massive, Ganymède, a une masse de 0,025 de la Terre. Ainsi la masse de Jupiter est 12 712 fois la masse de sa lune la plus massive.

Saturne a une masse de 95,159 de la Terre. Sa lune la plus massive, Titan, a une masse de 0,0225 Terre. Ainsi, la masse de Saturne est 4 229,28 fois la masse de sa lune la plus massive.

Uranus a une masse de 14,536 de la Terre. Sa lune la plus massive, Titania, a une masse de 0,0005908 de la Terre. Ainsi, la masse d'Uranus est 44 603,926 fois la masse de sa lune la plus massive.

Neptune a une masse de 17,147 de la Terre. Sa lune la plus massive, Triton, a une masse de 0,00359 de la Terre. Ainsi, la masse de Neptune est 4 776,3231 fois la masse de sa lune la plus massive.

Ainsi, selon les exemples de planètes géantes gazeuses de notre système solaire, une lune avec la masse de la Terre pourrait orbiter autour d'une planète géante gazeuse avec une masse de 4 229,28 ou 4 776,3231 fois la masse de la Terre, ce qui serait 13,307992 ou 15,029336 fois la masse de la Terre. masse de Jupiter. Ce serait un peu au-dessus de la limite de masse inférieure théorique pour une naine brune.

La lune la plus grande et la plus massive du système solaire, Ganymède, a un rayon de seulement ≈0,4R⊕ (R⊕ étant le rayon de la Terre) et une masse de ≈0,025M⊕. La question de savoir si des lunes beaucoup plus massives auraient pu se former autour des planètes extrasolaires est un domaine de recherche actif. Canup et Ward (2006) ont montré que les lunes formées dans le disque circumplanétaire des planètes géantes ont des masses ≲10−4 fois supérieures à la masse de la planète.

Canup R.M. Ward W.R. Une mise à l'échelle de masse commune pour les systèmes satellitaires de planètes gazeuses. La nature. 2006441 : 834–839. [PubMed]

La formation in situ à masse limitée devient critique pour les exomoons autour des planètes dans l'IHZ des étoiles de faible masse en raison du manque d'observation de ces planètes géantes. Une excellente étude sur la formation des systèmes satellitaires de Jupiter et de Saturne est donnée par Sasaki et al. (2010), qui ont montré que des lunes de tailles similaires à Io, Europa, Ganymède, Callisto et Titan devraient se former autour de la plupart des géantes gazeuses. De plus, selon leur Fig. 5 et leur communication privée avec Takanori Sasaki, la formation de lunes de masse martienne ou même terrestre autour de planètes géantes est possible. Selon qu'une planète accumule ou non une masse suffisante pour ouvrir une brèche dans le disque protostellaire, ces systèmes satellites seront probablement multiples et résonnants (comme dans le cas de Jupiter) ou ne contiendront qu'une seule lune majeure (voir Saturne). Ogihara et Ida (2012) ont étendu ces études pour expliquer le gradient de composition des satellites joviens. Leurs résultats expliquent pourquoi les lunes riches en eau sont plus éloignées de leur planète hôte géante et impliquent que la capture en résonances orbitales 2: 1 devrait être courante. Les moyens de contourner l'impasse d'une masse satellite insuffisante sont la capture gravitationnelle de lunes massives (Debes et Sigurdsson, 2007 Porter et Grundy, 2011 Quarles et al., 2012), qui semble avoir fonctionné pour Triton autour de Neptune (Goldreich et al., 1989 Agnor et Hamilton, 2006) la capture de chevaux de Troie (Eberle et al., 2011) la traînée de gaz dans les enveloppes circumplanétaires primordiales (Pollack et al., 1979) la capture déroulante piégeant temporairement des satellites ou des corps proches des points de Lagrangien sur des orbites stables ( Heppenheimer et Porco, 1977 Jewitt et Haghighipour, 2007) la coalescence des lunes (Mosqueira et Estrada, 2003) et les impacts sur les planètes telluriques (Canup, 2004 Withers et Barnes, 2010 Elser et al., 2011). De telles lunes correspondraient aux satellites irréguliers du système solaire, par opposition aux satellites réguliers qui se forment in situ. Les satellites irréguliers suivent souvent des orbites lointaines, inclinées et souvent excentriques voire rétrogrades autour de leur planète (Carruba et al., 2002). Pour l'instant, nous supposons qu'il existe des lunes extrasolaires de masse terrestre, qu'elles soient régulières ou irrégulières.

Sasaki T. Stewart G.R. Ida S. Origine des différentes architectures des systèmes satellitaires saturniens joviens. Astrophys J. 2010714 : 1052-1064.

Ogihara M. Ida S. Simulations à N-corps de la formation de satellites autour de planètes géantes : origine de la configuration orbitale des lunes galiléennes. Astrophys J. 2012753 doi : 10.1088/0004-637X/753/1/60.

Triton a une masse 2,0936 fois plus grande qu'une lune formée dans le disque circumplanétaire de Neptune devrait avoir selon Canup et Ward. Triton aurait été capturé par Neptune.

Titan a une masse 2,3644 fois plus grande qu'une lune formée dans le disque circumplanétaire de Saturne devrait avoir selon Canup et Ward. Ainsi Titan aurait dû acquérir sa masse par un ou plusieurs des processus suggérés pour permettre aux lunes de dépasser la limite de masse postulée par Canup et Ward.

Mais pourquoi les géantes gazeuses et leurs lunes sont-elles les seuls modèles pour les systèmes satellites des géantes gazeuses ?

La Terre est 81,300813 fois la masse de la Lune. En utilisant le système Terre-Lune comme modèle, une lune avec la masse de la Terre pourrait orbiter autour d'une planète géante gazeuse avec une masse 81,300813 fois la masse de la Terre, moins massive que Saturne.

La planète naine Pluton a une masse de 8,1967 fois sa plus grande lune, Charon. En utilisant le système Pluton-Charon comme modèle, une lune avec la masse de la Terre pourrait orbiter autour d'une planète géante gazeuse avec une masse 8,1967 fois la masse de la Terre, moins massive qu'Uranus.


Organisme de financement

Environ 68,8 % (1 143) des 1 662 articles contenaient des dossiers liés à l’agence de financement. Un projet de recherche peut bénéficier d'un soutien financier provenant de plus de deux subventions. Par conséquent, 3 452 enregistrements ont été extraits à l'aide de BibExcel, y compris le numéro de subvention, le texte du financement, etc. Pour éviter les écarts statistiques causés par différentes expressions d'un organisme de financement, comme un nom complet avec ou sans deuxième prénom ou initiale, ainsi que abréviations, tous ces enregistrements ont été identifiés et recomptés manuellement.

Les 20 premières agences de financement ont été triées en fonction du nombre d'articles (Chiffre 3). Le programme CTSA a eu l'impact financier le plus important sur la médecine translationnelle, publiant 30,2 % (503) des articles, suivi par les instituts du NIH, tels que le NCI et le NHLBI, publiant respectivement 4,0 % et 3,3 % (67 et 55) des articles. . Les agences de financement de l'Union européenne, de la Chine, du Japon, de l'Allemagne et du Canada ont également manifesté un grand intérêt dans ce domaine. Dans l'ensemble, la médecine translationnelle avait reçu de plus en plus d'attention de la part des gouvernements, des établissements universitaires et des entreprises pharmaceutiques du monde entier. 33, 34


5 réponses 5

Le fait est que parfois, des modèles différents (pour les mêmes données) peuvent conduire à des fonctions de vraisemblance qui diffèrent par une constante multiplicative, mais le contenu de l'information doit clairement être le même. Un exemple:

Nous modélisons $n$ expériences de Bernoulli indépendantes, conduisant aux données $X_1, dots, X_n$ , chacune avec une distribution de Bernoulli avec le paramètre (probabilité) $p$ . Cela conduit à la fonction de vraisemblance $ prod_^n p^ (1-p)^ <1-x_i>$ Ou nous pouvons résumer les données par la variable à distribution binomiale $Y=X_1+X_2+dotsm+X_n$ , qui a une distribution binomiale, conduisant à la fonction de vraisemblance $ inom p^y (1-p)^ $ qui, en fonction du paramètre inconnu $p$ , est proportionnel à l'ancienne fonction de vraisemblance. Les deux fonctions de vraisemblance contiennent clairement la même information, et devraient conduire aux mêmes inférences !

Et en effet, par définition, ils sont considérés comme la même fonction de vraisemblance.

Autre point de vue : observez que lorsque les fonctions de vraisemblance sont utilisées dans le théorème de Bayes, comme cela est nécessaire pour l'analyse bayésienne, de telles constantes multiplicatives s'annulent tout simplement ! ils sont donc clairement sans rapport avec l'inférence bayésienne. De même, il s'annulera lors du calcul des rapports de vraisemblance, tels qu'utilisés dans les tests d'hypothèse optimaux (lemme de Neyman-Pearson.) Et il n'aura aucune influence sur la valeur des estimateurs du maximum de vraisemblance. Nous pouvons donc voir que dans une grande partie de l'inférence fréquentiste, cela ne peut pas jouer de rôle.

On peut argumenter d'un autre point de vue encore. La fonction de probabilité de Bernoulli (ci-après nous utilisons le terme "densité") ci-dessus est vraiment une densité par rapport à la mesure de comptage, c'est-à-dire la mesure sur les entiers non négatifs avec une masse un pour chaque entier non négatif. Mais nous aurions pu définir une densité par rapport à une autre mesure dominante. Dans cet exemple, cela semblera (et est) artificiel, mais dans des espaces plus grands (espaces fonctionnels), c'est vraiment fondamental ! Utilisons, à des fins d'illustration, la distribution géométrique spécifique, notée $lambda$ , avec $lambda(0)=1/2$ , $lambda(1)=1/4$ , $lambda( 2)=1/8$ et ainsi de suite. Alors la densité de la distribution de Bernoulli par rapport à $lambda$ est donné par $ f_(x) = p^x (1-p)^<1-x>cdot 2^ $ signifiant que $ P(X=x)= f_lambda(x) cdot lambda(x) $ Avec cette nouvelle mesure dominante, la fonction de vraisemblance devient (avec la notation ci-dessus) $ prod_^n p^ (1-p)^ <1-x_i>2^ = p^y (1-p)^ 2^ $ notez le facteur supplémentaire $2^$ . Ainsi, lors du changement de la mesure dominante utilisée dans la définition de la fonction de vraisemblance, une nouvelle constante multiplicative apparaît, qui ne dépend pas du paramètre inconnu $p$ , et n'est clairement pas pertinente. C'est une autre façon de voir à quel point les constantes multiplicatives ne doivent pas être pertinentes. Cet argument peut être généralisé en utilisant des dérivés Radon-Nikodym (comme l'argument ci-dessus en est un exemple.)


Voir la vidéo: Aperçu de la biologie (Janvier 2022).